Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mus musculus musculus tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1) secondary structure diagram

Mus musculus musculus tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1) URS000047CD44_39442

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCUCCGUGGCGCAAUGGAUAGCGCAUUGGACUUCUAAUUCAAAGGUUCCGGGUUCGAGUCCCGGCGGAGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 59 other species

  1. Ailuropoda melanoleuca tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  2. Alligator mississippiensis tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  3. Anolis carolinensis tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  4. Balaenoptera acutorostrata scammoni tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  5. Bos taurus tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  6. Callithrix jacchus tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  7. Canis lupus familiaris tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  8. Cavia porcellus tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  9. Ceratotherium simum simum tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  10. Chlorocebus sabaeus tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  11. Choloepus hoffmanni tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  12. Chrysemys picta bellii tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  13. Columba livia partial tRNA-Arg
  14. Dasypus novemcinctus tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  15. Dipodomys ordii tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  16. Eptesicus nilssonii tRNA-Arg
  17. Equus caballus tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  18. Erinaceus europaeus tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  19. Felis catus tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  20. Gallus gallus tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  21. Geospiza fortis tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  22. Gorilla gorilla gorilla tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  23. Heterocephalus glaber tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  24. Homo sapiens tRNA-Arg (anticodon TCT) 1-1 (TRR-TCT1-1)
  25. Ictidomys tridecemlineatus tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  26. Latimeria chalumnae tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1, tRNA-Arg-TCT-2-2)
  27. Loxodonta africana tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  28. Macaca mulatta tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  29. Meleagris gallopavo tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  30. Melopsittacus undulatus tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  31. Microcebus murinus tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  32. Mus caroli tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  33. Mus musculus castaneus tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  34. Mus musculus domesticus tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  35. Mus musculus tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1, tRNA-Arg-TCT-3-1)
  36. Mus pahari tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  37. Mus spretus tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  38. Mustela putorius furo tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  39. Myotis lucifugus tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1, tRNA-Arg-TCT-2-2)
  40. Nomascus leucogenys tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  41. Ochotona princeps tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  42. Oryctolagus cuniculus tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  43. Otolemur garnettii tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  44. Ovis aries tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  45. Pan troglodytes tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  46. Papio anubis tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  47. Phrynosoma platyrhinos tRNA-OTHER
  48. Pongo abelii tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  49. Procavia capensis tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  50. Rattus norvegicus tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  51. Saimiri boliviensis boliviensis tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  52. Sarcophilus harrisii tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  53. Sorex araneus tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  54. Sus scrofa tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  55. Taeniopygia guttata tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  56. Trichechus manatus latirostris tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  57. Tursiops truncatus tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  58. Vicugna pacos tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  59. Xenopus tropicalis tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
2D structure Publications