v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Haplochromis burtoni (Burton's mouthbrooder) abu-miR-199-5p URS00004795FC_8153

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCCAGUGUUCAGACUACCUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Alligator mississippiensis (American alligator) ami-miR-199-5p
  2. Bos taurus bta-miR-199a-5p
  3. Chiloscyllium plagiosum microRNA cpl-miR-199
  4. Gadus morhua gmo-miR-199-5p
  5. Homo sapiens (human) Hsa-Mir-199-P2-v3_5p* (star (passenger))
  6. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72481
  7. Ornithorhynchus anatinus (platypus) oan-miR-199-5p
  8. Oryzias latipes ola-miR-199a-5p
  9. Paralichthys olivaceus pol-miR-199a-5p
  10. Pteropus alecto (black flying fox) pal-miR-199-5p
  11. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63162
  12. Taeniopygia guttata (zebra finch) tgu-miR-199-5p
  13. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-3212667