Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Saccharomyces cerevisiae S288C RNA of Unknown Function URS0000466DCE_559292

Genome locations

Gene Ontology annotations

Localisation

No annotated location

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUCAAUUAAUGAAUAAUUAGUUUGAUUAUUUUCCUCUUUAUUUGACCUUAGGAACAGUUUUUAAGGUAUACUCUGAACUGCAAAUUUUUGUCAUAACUCUUGGUAAUCAAGGCUAGAAGUGUACUAUUUUUGCUUUCUGCACAAGGCUUUUUCUUCGGUACGACACAAAAACAACUAUUGUGUCGCAGUCCAUAGAAGGAGCAAGAAAAAAGAAUGUCUUUAAAGGCGAAUGUGAUUCUAUGCUUUCUAGUACCUACUGUGCCGAAUAAUGUGUAAGUCUCAAAAUUCUUUUCUUCCAAAGCAUAUCCAUAAUAUUUACCUUACGCUGGGUAUUUUUUUUUUGGUCACUCCAGAUCUAGUUUUUUAAAACUUGAUCCCAACGUAACUAAAUAUAAACAAGACAAAGCUCGAAAUAAUAUAAUGUAAUUUAGCGAAUGUAGUGUUUAUAUCACCACAUUUGGAGAAUGUACAAUGAAUAGUUUCUCUGUCUCUAAUGGAAUAAGAAUUUAAUUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Saccharomyces cerevisiae (baker's yeast) RUF22
  2. Saccharomyces cerevisiae YJM1199 RUF22
  3. Saccharomyces cerevisiae YJM428 RUF22
  4. Saccharomyces cerevisiae YJM450 RUF22
  5. Saccharomyces cerevisiae YJM689 RUF22
Publications