Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Heliconius melpomene (postman butterfly) Hme-Mir-317_3p (mature (guide)) URS00004607CE_34740

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAACACAGCUGGUGGUAUCUCAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Aedes aegypti Aae-Mir-317-P8_3p (mature (guide))
  2. Apis mellifera ame-miR-317-3p
  3. Blattella germanica (German cockroach) Bge-Mir-317_3p (mature (guide))
  4. Bombyx mori Bombyx_mori piRNA piR-bmo-554109
  5. Centruroides sculpturatus Csc-Mir-317-P18_3p (mature (guide))
  6. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-317-3p
  7. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-317-3p
  8. Daphnia magna Dma-Mir-317_3p (mature (guide))
  9. Daphnia pulex dpu-miR-317
  10. Drosophila melanogaster (fruit fly) Drosophila_melanogaster piRNA piR-dme-32315111
  11. Hyalella azteca miR-317
  12. Limulus polyphemus Lpo-Mir-317-P12_3p (mature (guide))
  13. Nasonia giraulti ngi-miR-317
  14. Nasonia vitripennis nvi-miR-317
  15. Parasteatoda tepidariorum (common house spider) pte-miR-317-3p
  16. Penaeus japonicus miR-317
  17. Tribolium castaneum tca-miR-317-3p