v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-3734991 URS000044B6CD_8364

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUCACAGUGGCUAAGUUCUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Anolis carolinensis aca-miR-27b-3p
  2. Callorhinchus milii Cmi-Mir-27-P2_3p (mature (guide))
  3. Danio rerio dre-miR-27b-3p
  4. Eptatretus burgeri (inshore hagfish) Ebu-Mir-27-P6_3p (mature (guide))
  5. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-8319577
  6. Ophiophagus hannah oha-miR-27b-3p
  7. Scyliorhinus torazame Sto-Mir-27-P2_3p (mature (guide))
  8. Takifugu rubripes fru-miR-27b
  9. Tetraodon nigroviridis tni-miR-27b
  10. Tor tambroides (Thai mahseer) miR-27b-3p
  11. Xenopus laevis (African clawed frog) xla-miR-27b-3p