Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-579 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-579 precursor URS0000440A79_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mir579: MIR579 is a microRNA (miRNA) that has been implicated in various physiological and pathological processes, including cardiotoxicity and noradrenergic signaling. Elevated levels of MIR579 have been specifically associated with cardiotoxicity in patients treated with bevacizumab, a phenomenon that is not replicated by artificially engineering a CNNC motif into MIR579 [PMC7578723][PMC5340965]. The MIR579 gene is located within the putative promoter region upstream of the gene and has been linked to the regulation of several genes involved in fear and anxiety [PMC6195525]. Notably, the minor (T)-allele of rs2910931 upstream of MIR579 has been associated with increased expression of hsa-miR-579-3p, leading to more effective repression of SLC6A2 expression and higher synaptic noradrenaline levels [PMC6195525]. This genetic variation may contribute to higher trait anxiety and panic disorder (PD) susceptibility due to increased sympathetic noradrenergic arousal [PMC6195525]. Additionally, MIR579's role in diabetic microvascular complications has been highlighted, where its inhibition leads to increased expression of protective vascular factors [PMC8631471][PMC9563036]. Conservation studies have confirmed the presence of MIR579 among several primate species but not in more distantly related species such as mice or rats, limiting validation studies to primate models [PMC6195525].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAUAUUAGGUUAAUGCAAAAGUAAUCGCGGUUUGUGCCAGAUGACGAUUUGAAUUAAUAAAUUCAUUUGGUAUAAACCGCGAUUAUUUUUGCAUCAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression Publications