Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 199a-2 (ENSNLEG00000023217.2) URS000043F622_61853

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 32 other species

  1. Aotus nancymaae miRNA (ENSANAG00000013519.1)
  2. Callithrix jacchus (white-tufted-ear marmoset) miRNA (ENSCJAG00000042250.2)
  3. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000018096.1)
  4. Chlorocebus sabaeus microRNA 199a-2 (ENSCSAG00000020384.1)
  5. Colobus angolensis palliatus miRNA (ENSCANG00000038104.1)
  6. Gorilla gorilla gorilla ggo-mir-199a (ENSGGOG00000033976.2)
  7. Gorilla gorilla microRNA ggo-mir-199a precursor
  8. Homo sapiens microRNA hsa-mir-199a precursor (hsa-mir-199a-2)
  9. Macaca fascicularis (Crab-eating macaque) microRNA 199a-2 (ENSMFAG00000012003.2)
  10. Macaca mulatta microRNA mml-mir-199a precursor (mml-mir-199a-1)
  11. Macaca nemestrina microRNA mne-mir-199a precursor
  12. Mandrillus leucophaeus miRNA (ENSMLEG00000013365.1)
  13. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-199a precursor
  14. Pan troglodytes microRNA ptr-mir-199a precursor (ptr-mir-199a-2)
  15. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000015303.1)
  16. Pongo abelii (Sumatran orangutan) microRNA 199a-2 (ENSPPYG00000021109.2)
  17. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-199a precursor
  18. Prolemur simus (greater bamboo lemur) microRNA 199a-2 (ENSPSMG00000008030.1)
  19. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000008656.1)
  20. Rhinopithecus bieti miRNA (ENSRBIG00000008477.1)
  21. Rhinopithecus roxellana (Golden snub-nosed monkey) microRNA 199a-2 (ENSRROG00000002905.1)
  22. Saguinus labiatus microRNA sla-mir-199a precursor
  23. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) microRNA 199a-2 (ENSSBOG00000017075.1)
  24. Theropithecus gelada microRNA 199a-2 (ENSTGEG00000004928.1)
Publications