v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) BMF antisense RNA 1 URS000043DFC5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bmf-as1: BMF-AS1, identified as a long non-coding RNA (lncRNA) transcribed from the BMF locus, has been implicated in the regulation of vascular smooth muscle cell (VSMC) calcification and senescence [PMC9937703]. This lncRNA is upregulated in VSMCs exposed to high glucose and in aortic tissues from diabetic mice, suggesting a role in diabetic vascular complications [PMC9937703]. BMF-AS1 enhances the expression of BMF, an actin-binding protein, at both mRNA and protein levels through direct interaction [PMC9937703]. Knockdown experiments using siRNA against BMF-AS1 demonstrated that reducing its levels attenuates VSMC calcification and senescence, as evidenced by decreased expression of senescence markers such as Runx2, ALP, p21, and p16 [PMC9937703]. Conversely, overexpression of BMF-AS1 exacerbates these cellular processes [PMC9937703]. The study also revealed that the absence of BMF-AS1 leads to accelerated degradation of BMF mRNA [PMC9937703], while overexpression protects against such degradation [PMC9937703]. These findings underscore the regulatory role of BMF-AS1 on its cognate gene BMF and highlight its potential impact on vascular pathologies associated with diabetes.

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUGAAACAGGCCAGGCAGAGGCCAGGCUGAGUCCUCCACCCUCAUUGCAGGAGUCCAGCGUCUGGCCUGGGGACUUCCCUCACCAGAUCUGUUGACCAACUUCUAGAAACCCCUGCUUUGGGGUUGUGAAUUAGAAGGGCUGUUUUGACCCUGAAUAUCAGGCUUCCCUUCCUCCCAGGCAUUUCUUUCCCGAGGAGGAAGGUUUCCAGUCCCUCUCCCAACCCCCACCCUCAGCAAGCCACAAAGCCUCCACCGUCUUCAGCUGGUUACAGGUCAGGAUCCAGGUCGGGGGGGAGGGGCAGGUCUCCUGAGGCUAGACUUGAGGAAUGUUUAGGCCAACUCACCAGGCAGAGGAGGAAGGGGCCAGUUUAGAUCACUAAGCCAAUUAAAAACAACCAGCCAGAAAGAACCUUUCUCCUUCCUGACAGCUACUCUGCCAGCUACCUCCUGGGUUUUGUUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

 Expression Publications