Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) BMF antisense RNA 1 (BMF-AS1) URS000043DFC5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

BMF-AS1: BMF-AS1 is a long non-coding RNA (lncRNA) that is transcribed from the negative strand of the BMF gene [PMC9937703]. It has been found to play a role in the calcification and senescence of vascular smooth muscle cells (VSMCs) [PMC9937703]. BMF-AS1 regulates the actin-binding protein BMF and promotes high glucose-induced VSMC calcification and senescence [PMC9937703]. It interacts with BMF at both the mRNA and protein levels, upregulating its expression [PMC9937703]. Knocking down BMF-AS1 accelerates the degradation of BMF mRNA in VSMCs, while overexpression of BMF-AS1 protects it [PMC9937703]. In VSMCs induced by high glucose and aorta tissues from diabetic mice, both BMF-AS1 and BMF expression are increased [PMC9937703]. Overexpression or knockdown of either BMF or BMF-AS1 affects VSMC calcification and senescence, with overexpression exacerbating it and knockdown attenuating it [PMC9937703]. The expression of BMF-AS1 is regulated by histone deacetylase inhibitor TSA but not by 5-aza-2’-deoxycytidine, a methyltransferase inhibitor [PMC9937703]. The location of BMF-AS1 is mainly in the cytoplasm but also at a low level in the nucleus of VSMCs, with high glucose treatment increasing its expression [PMC9937703]. The detailed mechanisms underlying its regulation in VSMC calcification and senescence require further exploration [PMC9937703]. Reference: [PMC9937703]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGAAACAGGCCAGGCAGAGGCCAGGCUGAGUCCUCCACCCUCAUUGCAGGAGUCCAGCGUCUGGCCUGGGGACUUCCCUCACCAGAUCUGUUGACCAACUUCUAGAAACCCCUGCUUUGGGGUUGUGAAUUAGAAGGGCUGUUUUGACCCUGAAUAUCAGGCUUCCCUUCCUCCCAGGCAUUUCUUUCCCGAGGAGGAAGGUUUCCAGUCCCUCUCCCAACCCCCACCCUCAGCAAGCCACAAAGCCUCCACCGUCUUCAGCUGGUUACAGGUCAGGAUCCAGGUCGGGGGGGAGGGGCAGGUCUCCUGAGGCUAGACUUGAGGAAUGUUUAGGCCAACUCACCAGGCAGAGGAGGAAGGGGCCAGUUUAGAUCACUAAGCCAAUUAAAAACAACCAGCCAGAAAGAACCUUUCUCCUUCCUGACAGCUACUCUGCCAGCUACCUCCUGGGUUUUGUUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications