v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae (baker's yeast) Small nucleolar RNA snR48 secondary structure diagram

Saccharomyces cerevisiae (baker's yeast) Small nucleolar RNA snR48 URS000043D99E_4932

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCAUAAUGAUGAUUUCACUUAUACCUAUAUGUUUUUUCUGGCAUCUCUAAUGUUAGGAUGUGAAGUUUAAGUACUCUCCAUUCAAUGAAUACAAUUUUUGACAAUAUCUGAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Saccharomyces cerevisiae AWRI796 Small nucleolar RNA snR48
  2. Saccharomyces cerevisiae P283 SNR48
  3. Saccharomyces cerevisiae S288C Small Nucleolar RNA
 2D structure Publications