Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca mulatta (Rhesus monkey) Mml-Mir-214-v2_3p (mature (guide)) URS000042BD45_9544

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACAGCAGGCACAGACAGGCAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-214-v2_3p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-214-v2_3p (mature (guide))
  3. Bos taurus Bta-Mir-214-v2_3p (mature (guide))
  4. Callorhinchus milii Cmi-Mir-214-v2_3p (mature (guide))
  5. Canis lupus familiaris (dog) Cfa-Mir-214-v2_3p (mature (guide))
  6. Cavia porcellus Cpo-Mir-214-v2_3p (mature (guide))
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-214-v2_3p (mature (guide))
  8. Columba livia Cli-Mir-214-v2_3p (mature (guide))
  9. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-214-v2_3p (mature (guide))
  10. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-214-v2_3p (mature (guide))
  11. Eptesicus fuscus (big brown bat) efu-miR-214
  12. Gallus gallus (chicken) Gga-Mir-214-v2_3p (mature (guide))
  13. Gekko japonicus Gja-Mir-214-v2_3p (mature (guide))
  14. Homo sapiens (human) Hsa-Mir-214-v2_3p (mature (guide))
  15. Monodelphis domestica Mdo-Mir-214-v2_3p (mature (guide))
  16. Mus musculus Mmu-Mir-214-v2_3p (mature (guide))
  17. Ornithorhynchus anatinus Oan-Mir-214-v2_3p (mature (guide))
  18. Oryctolagus cuniculus (rabbit) Ocu-Mir-214-v2_3p (mature (guide))
  19. Python bivittatus (Burmese python) Pbv-Mir-214-v2_3p (mature (guide))
  20. Rattus norvegicus Rno-Mir-214-v2_3p (mature (guide))
  21. Sarcophilus harrisii Sha-Mir-214-v2_3p (mature (guide))
  22. Scyliorhinus torazame (cloudy catshark) Sto-Mir-214-v2_3p (mature (guide))
  23. Taeniopygia guttata (zebra finch) Tgu-Mir-214-v2_3p (mature (guide))
  24. Xenopus laevis (African clawed frog) Xla-Mir-214-P3-v2_3p (mature (guide))
  25. Xenopus tropicalis Xtr-Mir-214-v2_3p (mature (guide))