Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1972 URS000042A1A2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1972: Hsa-mir-1972 is a microRNA that has been implicated in the regulation of gene expression in various pathological conditions. It has been shown to target and inhibit the expression of BAIAP3 in vitro, suggesting a role in cellular processes that BAIAP3 may influence [PMC7906144]. In a study comparing patients with Common Variable Immunodeficiency (CVID) before and after treatment, hsa-mir-1972 was among the microRNAs with significant expression changes, indicating its potential involvement in the immune response or disease progression [PMC7722869]. Additionally, hsa-mir-1972 is involved in regulating THSD4, a down-regulated gene according to a DEmiRNA-DEmRNA interaction network analysis, which may have implications for understanding its role in disease mechanisms [PMC8799076]. In the context of leukoaraiosis (LA), hsa-mir-1972 was significantly altered and associated with up-regulated mRNAs within white matter lesion (WML) tissue, suggesting its involvement in LA pathogenesis [PMC7906144]. Furthermore, lower plasma levels of hsa-mir-1972 have been confirmed by quantitative PCR in patients with type I LA compared to controls without LA [PMC7906144]. Lastly, hsa-mir-1972 was found to be downregulated among patients with ankylosing spondylitis (AS), which supports its potential as a biomarker for disease progression and understanding disease targets and factors [PMC7795580].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGGCCAGGCACAGUGGCUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

Publications