Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Ictidomys tridecemlineatus tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3) secondary structure diagram

Ictidomys tridecemlineatus tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3) URS0000417A0F_43179

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGGGUAUAGCUCAGUGGUAGAGCAUUUGACUGCAGAUCAAGAGGUCCCCGGUUCAAAUCCGGGUGCCCCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 127 other species

  1. Ailuropoda melanoleuca tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  2. Albula glossodonta tRNA-OTHER
  3. Albula goreensis tRNA-Cys
  4. Alligator mississippiensis tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1, tRNA-Cys-GCA-1-2)
  5. Alosa alosa tRNA-Cys
  6. Amazona aestiva tRNA
  7. Ameiurus melas tRNA-Cys
  8. Anas platyrhynchos tRNA
  9. Anguilla anguilla (European eel) tRNA-Cys
  10. Aptenodytes forsteri tRNA
  11. Astyanax mexicanus tRNA
  12. Ataeniobius toweri tRNA-Cys
  13. Balaenoptera acutorostrata scammoni tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 4)
  14. Bos taurus tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  15. Callipepla squamata tRNA
  16. Callithrix jacchus tRNA-Cys (GCA) (tRNA-Cys-GCA-3-1, tRNA-Cys-GCA-3-2)
  17. Calypte anna tRNA
  18. Camelus ferus tRNA
  19. Canis lupus familiaris tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  20. Antrostomus carolinensis tRNA
  21. Carlito syrichta tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1, tRNA-Cys-GCA-1-2)
  22. Cavia porcellus tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1, tRNA-Cys-GCA-1-2)
  23. Ceratotherium simum simum tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1, tRNA-Cys-GCA-1-2)
  24. Chaetura pelagica (chimney swift) tRNA
  25. Characodon lateralis tRNA-Cys
  26. Charadrius vociferus tRNA
  27. Chelonia mydas (green seaturtle) tRNA
  28. Chelydra serpentina tRNA-Cys
  29. Chlamydotis macqueenii tRNA
  30. Chlorocebus sabaeus tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  31. Choloepus hoffmanni tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1, tRNA-Cys-GCA-1-2)
  32. Chrysemys picta bellii tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1, tRNA-Cys-GCA-1-2)
  33. Colinus virginianus tRNA
  34. Columba livia tRNA
  35. Crenichthys baileyi tRNA-Cys
  36. Cricetulus griseus tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  37. Cuculus canorus tRNA
  38. Dallia pectoralis tRNA-Cys
  39. Danionella translucida tRNA-Cys
  40. Danio rerio tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 8)
  41. Dasypus novemcinctus tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  42. Dicentrarchus labrax (European seabass) transfer RNA-Cys
  43. Dipodomys ordii tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  44. Echinops telfairi tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  45. Equus caballus tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 4)
  46. Erinaceus europaeus tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  47. Eschrichtius robustus tRNA-Cys
  48. Felis catus tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  49. Fukomys damarensis tRNA
  50. Gadus morhua tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  51. Gallus gallus tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  52. Gasterosteus aculeatus tRNA
  53. Gavia stellata tRNA
  54. Geospiza fortis tRNA-Cys (GCA) (tRNA-Cys-GCA-2-1, tRNA-Cys-GCA-2-2)
  55. Gorilla gorilla gorilla tRNA-Cys (GCA) (tRNA-Cys-GCA-3 1 to 3)
  56. Heterocephalus glaber tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1, tRNA-Cys-GCA-1-2)
  57. Hippoglossus stenolepis (Pacific halibut) tRNA-Cys
  58. Homo sapiens tRNA-Cys (anticodon GCA) 2-1 (TRC-GCA2 1 to 4)
  59. Lamprotornis superbus tRNA-OTHER
  60. Larimichthys crocea tRNA
  61. Lepisosteus oculatus (spotted gar) tRNA
  62. Loxodonta africana tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  63. Macaca mulatta tRNA-Cys (GCA) (tRNA-Cys-GCA-3 1 to 4)
  64. Marmota monax (woodchuck) tRNA.Cys
  65. Megalops atlanticus (tarpon) tRNA-Cys
  66. Meleagris gallopavo tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  67. Melopsittacus undulatus tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  68. Merops nubicus tRNA
  69. Mesocricetus auratus tRNA
  70. Microcebus murinus tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  71. Monodelphis domestica tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  72. Mus caroli tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 4)
  73. Mus musculus castaneus tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 4)
  74. Mus musculus domesticus tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 4)
  75. Mus musculus musculus tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 4)
  76. Mus musculus tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 4, tRNA-Cys-GCA-3 1 to 4)
  77. Mus pahari tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 4)
  78. Mus spretus tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 4)
  79. Mustela putorius furo tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  80. Myotis brandtii tRNA
  81. Myotis davidii tRNA
  82. Myotis lucifugus tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  83. Neotoma lepida (desert woodrat) tRNA
  84. Nomascus leucogenys tRNA-Cys (GCA) (tRNA-Cys-GCA-3 1 to 3)
  85. Notamacropus eugenii tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1, tRNA-Cys-GCA-1-2)
  86. Nothobranchius furzeri tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 4)
  87. Ochotona princeps tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 5)
  88. Oesophagostomum dentatum tRNA
  89. Opisthocomus hoazin tRNA
  90. Oreochromis niloticus tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 4)
  91. Ornithorhynchus anatinus tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 7)
  92. Oryctolagus cuniculus tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  93. Oryzias latipes tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  94. Otolemur garnettii tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  95. Ovis aries tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  96. Pangasianodon gigas (Mekong giant catfish) tRNA-Cys
  97. Pangasianodon hypophthalmus tRNA-Cys
  98. Pangasius djambal tRNA-Cys
  99. Pan troglodytes tRNA-Cys (GCA) (tRNA-Cys-GCA-3 1 to 3)
  100. Papio anubis tRNA-Cys (GCA) (tRNA-Cys-GCA-3-1, tRNA-Cys-GCA-3-2)
  101. Patagioenas fasciata monilis tRNA
  102. Perca flavescens tRNA-Cys
  103. Perca fluviatilis (European perch) tRNA-Cys
  104. Petromyzon marinus tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1, tRNA-Cys-GCA-1-2)
  105. Pleuronectes platessa tRNA-Cys
  106. Poecilia formosa tRNA
  107. Pongo abelii tRNA-Cys (GCA) (tRNA-Cys-GCA-2 1 to 3)
  108. Procavia capensis tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  109. Pteropus alecto (black flying fox) tRNA
  110. Pygoscelis adeliae (Adelie penguin) tRNA
  111. Rattus norvegicus tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 4)
  112. Saimiri boliviensis boliviensis tRNA-Cys (GCA) (tRNA-Cys-GCA-3-1, tRNA-Cys-GCA-3-2)
  113. Salmo salar tRNA
  114. Sarcophilus harrisii tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  115. Scleropages formosus (Asian bonytongue) tRNA
  116. Sorex araneus tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  117. Struthio camelus australis tRNA
  118. Sus scrofa tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  119. Takifugu rubripes tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1, tRNA-Cys-GCA-1-2)
  120. Tauraco erythrolophus (red-crested turaco) tRNA
  121. Tetraodon nigroviridis tRNA
  122. Tinamus guttatus tRNA
  123. Trichechus manatus latirostris tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1, tRNA-Cys-GCA-1-2)
  124. Tupaia chinensis (Chinese tree shrew) tRNA
  125. Tursiops truncatus tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1, tRNA-Cys-GCA-1-2)
  126. Vicugna pacos tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 3)
  127. Xiphophorus maculatus tRNA
2D structure Publications