Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Chlorocebus sabaeus tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1, tRNA-Arg-ACG-1-2) secondary structure diagram

Chlorocebus sabaeus tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1, tRNA-Arg-ACG-1-2) URS0000416E93_60711

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGCCAGUGGCGCAAUGGAUAACGCGUCUGACUACGGAUCAGAAGAUUCCAGGUUCGACUCCUGGCUGGCUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 72 other species

  1. Ailuropoda melanoleuca tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  2. Albula glossodonta tRNA-OTHER
  3. Ameiurus melas tRNA-Arg
  4. Anguilla anguilla (European eel) tRNA-Arg
  5. Balaenoptera acutorostrata scammoni tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  6. Bos taurus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  7. Callithrix jacchus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  8. Camelus ferus tRNA
  9. Canis lupus familiaris tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1, tRNA-Arg-ACG-1-2)
  10. Carlito syrichta tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  11. Cavia porcellus tRNA-Arg (ACG) (tRNA-Arg-ACG-2-1, tRNA-Arg-ACG-2-2)
  12. Ceratotherium simum simum tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  13. Choloepus hoffmanni tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  14. Cricetulus griseus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  15. Dasypus novemcinctus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  16. Dipodomys ordii tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1, tRNA-Arg-ACG-1-2)
  17. Echinops telfairi tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1, tRNA-Arg-ACG-1-2)
  18. Equus caballus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  19. Erinaceus europaeus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  20. Felis catus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  21. Fukomys damarensis tRNA
  22. Gadus morhua tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  23. Gasterosteus aculeatus tRNA
  24. Gorilla gorilla gorilla tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  25. Heterocephalus glaber tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  26. Hippoglossus stenolepis (Pacific halibut) tRNA-Arg
  27. Homo sapiens tRNA-Arg (anticodon ACG) 1-1 (TRR-ACG1 1 to 3)
  28. Ictidomys tridecemlineatus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  29. Loxodonta africana tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  30. Macaca mulatta tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  31. Marmota monax (woodchuck) tRNA.Arg
  32. Mesocricetus auratus tRNA
  33. Microcebus murinus tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1, tRNA-Arg-ACG-1-2)
  34. Monodelphis domestica tRNA-Arg (ACG) (tRNA-Arg-ACG-2-1)
  35. Mus caroli tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  36. Mus musculus castaneus tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 3)
  37. Mus musculus domesticus tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 3)
  38. Mus musculus musculus tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 3)
  39. Mus musculus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3, tRNA-Arg-ACG-2 1 to 3)
  40. Mus pahari tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  41. Mus spretus tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 3)
  42. Mustela putorius furo tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  43. Myotis brandtii tRNA
  44. Myotis davidii tRNA
  45. Myotis lucifugus tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1, tRNA-Arg-ACG-1-2)
  46. Neotoma lepida (desert woodrat) tRNA
  47. Nomascus leucogenys tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  48. Notamacropus eugenii tRNA-Arg (ACG) (tRNA-Arg-ACG-2-1)
  49. Ochotona princeps tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1, tRNA-Arg-ACG-1-2)
  50. Ornithorhynchus anatinus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  51. Oryctolagus cuniculus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  52. Otolemur garnettii tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1, tRNA-Arg-ACG-1-2)
  53. Ovis aries tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  54. Pangasianodon hypophthalmus tRNA-Arg
  55. Pan troglodytes tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  56. Papio anubis tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  57. Pongo abelii tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  58. Procavia capensis tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  59. Pteropus alecto (black flying fox) tRNA
  60. Rattus norvegicus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  61. Saimiri boliviensis boliviensis tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  62. Sarcophilus harrisii tRNA-Arg (ACG) (tRNA-Arg-ACG-2-1)
  63. Sorex araneus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  64. Sus scrofa tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  65. Takifugu rubripes tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1)
  66. Tetraodon nigroviridis tRNA
  67. Trichechus manatus latirostris tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  68. Tupaia chinensis (Chinese tree shrew) tRNA
  69. Tursiops truncatus tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 3)
  70. Vicugna pacos tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  71. Xenopus laevis tRNA
  72. Xiphophorus maculatus tRNA
2D structure Publications