Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus laevis (African clawed frog) Xla-Mir-199-P1c-v1_3p (mature (guide)) URS00003F2D94_8355

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACAGUAGUCUGCACAUUGGUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 42 other species

  1. Alligator mississippiensis (American alligator) ami-miR-199-3p
  2. Anolis carolinensis (green anole) Aca-Mir-199-P2-v1_3p (mature (guide))
  3. Bos taurus (cattle) bta-miR-199a-3p
  4. Callorhinchus milii Cmi-Mir-199-P2-v1_3p (mature (guide))
  5. Canis lupus familiaris (dog) Cfa-Mir-199-P2-v1_3p (mature (guide))
  6. Cavia porcellus (domestic guinea pig) cpo-miR-199-3p
  7. Chiloscyllium plagiosum microRNA cpl-miR-199a-3p
  8. Chrysemys picta bellii (western painted turtle) Cpi-Mir-199-P2-v1_3p (mature (guide))
  9. Chrysemys picta cpi-miR-199-3p
  10. Columba livia (rock pigeon) Cli-Mir-199-P2-v1_3p (mature (guide))
  11. Danio rerio (zebrafish) Dre-Mir-199-P2b-v1_3p (mature (guide))
  12. Dasypus novemcinctus dno-miR-199-3p
  13. Echinops telfairi Ete-Mir-199-P2-v1_3p (mature (guide))
  14. Equus caballus eca-miR-199b-3p
  15. Gadus morhua gmo-miR-199-3p
  16. Gallus gallus Gga-Mir-199-P2-v1_3p (mature (guide))
  17. Gekko japonicus Gja-Mir-199-P2-v1_3p (mature (guide))
  18. Homo sapiens (human) hsa-miR-199b-3p
  19. Latimeria chalumnae (coelacanth) Lch-Mir-199-P2_3p (mature (guide))
  20. Lepisosteus oculatus Loc-Mir-199-P2-v1_3p (mature (co-guide))
  21. Macaca fascicularis microRNA miR-199b-3p
  22. Macaca mulatta mml-miR-199a-3p
  23. Microcaecilia unicolor Mun-Mir-199-P1-v1_3p (mature (guide))
  24. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-199-P2-v1_3p (mature (guide))
  25. Monopterus albus Mal-Mir-199-P2a-v1_3p (mature (guide))
  26. Mus musculus mmu-miR-199a-3p
  27. Ophiophagus hannah oha-miR-199a-3p
  28. Ornithorhynchus anatinus (platypus) Oan-Mir-199-P2-v1_3p (mature (guide))
  29. Oryctolagus cuniculus (rabbit) ocu-miR-199a-3p
  30. Oryzias latipes ola-miR-199a-3p
  31. Pan troglodytes ptr-miR-199a-3p
  32. Paralichthys olivaceus (Japanese flounder) pol-miR-199a-3p
  33. Petromyzon marinus Pma-Mir-199-o2-v1_3p (mature (guide))
  34. Python bivittatus (Burmese python) Pbv-Mir-199-P2-v1_3p (mature (guide))
  35. Rattus norvegicus (Norway rat) rno-miR-199a-3p
  36. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-199-P2-v1_3p (mature (guide))
  37. Scyliorhinus torazame Sto-Mir-199-P2-v1_3p (mature (guide))
  38. Sphenodon punctatus Spt-Mir-199-P2_3p (mature (guide))
  39. Sus scrofa (pig) ssc-miR-199a-3p
  40. Taeniopygia guttata Tgu-Mir-199-P2-v1_3p (mature (guide))
  41. Tetraodon nigroviridis Tni-Mir-199-P1b-v1_3p (mature (guide))
  42. Xenopus tropicalis Xtr-Mir-199-P1-v1_3p (mature (guide))