v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) RNA, U2 small nuclear 1 (RNU2-1) secondary structure diagram

Homo sapiens (human) RNA, U2 small nuclear 1 (RNU2-1) URS00003EE995_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

RNU2-1: RNU2-1 is a type of U2 small nuclear RNA (snRNA) [PMC5325768]. The poly-A tailing SYBR strategy is a method that can distinguish between miR-1246 and RNU2-1 by analyzing the sizes of the amplified fragments and assessing their melting curves [PMC8762223]. Cumulative plots were generated from reads mapping to various U1, U4, U5, and U6 variants, while separate cumulative plots were created for reads mapping to RNU2-1 and RNU2-2P genes for the U2 snRNA [PMC5325768]. The reads were trimmed for the A and CA tails that are added to mature RNU2-1 and RNU2-2P RNAs, respectively. This trimming allows discrimination between mature U2 snRNAs and those that are incompletely 3' end exonucleolytically processed [PMC5325768].

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUCGCUUCUCGGCCUUUUGGCUAAGAUCAAGUGUAGUAUCUGUUCUUAUCAGUUUAAUAUCUGAUACGUCCUCUAUCCGAGGACAAUAUAUUAAAUGGAUUUUUGGAGCAGGGAGAUGGAAUAGGAGCUUGCUCCGUCCACUCCACGCAUCGACCUGGUAUUGCAGUACCUCCAGGAACGGUGCACCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Gorilla gorilla U2 small nuclear RNA
  2. Papio hamadryas non-coding RNA
 2D structure Publications