Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 80E (SNORA80E) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 80E (SNORA80E) URS00003D5684_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA80E: SNORA80E is a non-coding RNA belonging to the small nucleolar RNA family [PMC6736983]. It acts as an oncogene, promoting cell proliferation and limiting apoptosis and cancer stem cell (CSC) maintenance [PMC7140444]. Overexpression of SNORA80E in normal bronchial epithelial cells (BEAS-2B) and in the H1299 NSCLC cell line leads to increased cell proliferation and soft agar colony formation [PMC7140444]. Inhibition of SNORA80E through siRNA transfection results in decreased cell proliferation, increased apoptosis, and cleavage of caspase-3 and PARP1 [PMC7140444]. Downregulation of SNORA80E expression is expected to reduce tumor cell proliferation [PMC6736983]. Two studies from the laboratory of Jiang have investigated the role of SNORA80E in lung tumorigenesis [PMC7140444]. In lung cancer tissue samples, SNORA80E is significantly overexpressed compared to healthy donors, along with other snoRNAs such as SNORD78 [PMC7140444]. Furthermore, SNORA80E is highly expressed in tumor-initiating cells (TICs) compared to differentiated lung cancer cells [PMC7140444]. References: - PMC6736983 - PMC7140444

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGUAAUGGAUUUAUGGUGGGUCCUUCUCUGUGGGCCUCUCAUAGUGUACCCAUGCCAUAGCAAAUGGCAGCCUCGAACCAUUGCCCAGUCCCCUUACCUGUGGGCUGUGAGCACUGAAGGGGGUUGCACAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications