Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Macaca mulatta (Macaque) small nucleolar RNA, C/D box 86 (ENSMMUG00000032819.3) secondary structure diagram

Macaca mulatta (Macaque) small nucleolar RNA, C/D box 86 (ENSMMUG00000032819.3) URS00003D103A_9544

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAUCACGGUGAUGGCUGACCAGGGCUCCCUGACCUAUACAGGCCUCUGCUAUGGGGGUGAUGGCCAGUCCUGGUGUCUGAGUGAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Aotus nancymaae small nucleolar RNA, C/D box 86 (ENSANAG00000009083.1)
  2. Camelus dromedarius (Arabian camel) small nucleolar RNA, C/D box 86 (ENSCDRG00005010982.1)
  3. Camelus ferus (Wild Bactrian camel) Small nucleolar RNA SNORD86
  4. Cebus imitator small nucleolar RNA, C/D box 86 (ENSCCAG00000008735.1)
  5. Cercocebus atys (Sooty mangabey) small nucleolar RNA, C/D box 86 (ENSCATG00000022016.1)
  6. Chlorocebus sabaeus (African green monkey) small nucleolar RNA, C/D box 86 (ENSCSAG00000021708.1)
  7. Colobus angolensis palliatus (Angola colobus) snoRNA (ENSCANG00000010170.1)
  8. Gorilla gorilla gorilla (Western Lowland Gorilla) small nucleolar RNA, C/D box 86 (ENSGGOG00000032461.2)
  9. Homo sapiens small nucleolar RNA, C/D box 86 (SNORD86)
  10. Macaca fascicularis small nucleolar RNA, C/D box 86 (ENSMFAG00000023584.2)
  11. Macaca nemestrina (Pig-tailed macaque) small nucleolar RNA, C/D box 86 (ENSMNEG00000002690.1)
  12. Mandrillus leucophaeus (Drill) small nucleolar RNA, C/D box 86 (ENSMLEG00000012009.1)
  13. Pan paniscus small nucleolar RNA, C/D box 86 (ENSPPAG00000003035.1)
  14. Pan troglodytes small nucleolar RNA, C/D box 86 (ENSPTRG00000032706.2)
  15. Papio anubis (olive baboon) small nucleolar RNA, C/D box 86 (ENSPANG00000005585.3)
  16. Piliocolobus tephrosceles snoRNA (ENSPTEG00000032783.1)
  17. Pongo abelii small nucleolar RNA, C/D box 86 (ENSPPYG00000025076.2)
  18. Rhinopithecus bieti small nucleolar RNA, C/D box 86 (ENSRBIG00000029846.1)
  19. Rhinopithecus roxellana (Golden snub-nosed monkey) small nucleolar RNA, C/D box 86 (ENSRROG00000008436.1)
  20. Theropithecus gelada (gelada) small nucleolar RNA SNORD86 (ENSTGEG00000011070.1)
2D structure Publications