Homo sapiens (human) small nucleolar RNA, C/D box 97 (SNORD97)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small nucleolar RNA, C/D box 97 (SNORD97) URS00003B57B1_9606

142 nucleotides
8 databases (ENA, Ensembl, GeneCards, HUGO Gene Nomenclature Committee, MalaCards, RefSeq, RFAM, snoDB)
Found in 0 other species
95 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

snord97: SNORD97, a small nucleolar RNA, may partially localize to the nucleoplasm and be involved in the 2′-O-methylation of tRNAMet(CAT) [PMC6601510]. To study SNORD97, it was cloned into an expression vector; specifically, the SNORD97 gene was PCR-amplified and inserted into the pGL vector at ClaI and XhoI restriction sites [PMC6601510].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UUGCCCGAUGAUUAUAAAAAGACGCGUUAUUAAGAGGACUUUAUGCUGGAGUUCUUGACGUUUUUCUCUCUUUUCUAUACUUCUUUUUCUUUCUUUGAAUGUCCAGCGUCCUGUGAGCGAAGAUUAUGAGAUAUGAGGGCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression

Publications