Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 97 (SNORD97) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 97 (SNORD97) URS00003B57B1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD97: SNORD97 is a type of small nucleolar RNA that may localize to the nucleoplasm and be involved in directing the 2'-O-methylation of tRNAMet(CAT) [PMC6601510]. In order to construct pGL/SNORD97 and pGL/SCARNA97 expression plasmids, the human SNORD97 and SCARNA97 genes were PCR-amplified and inserted into the ClaI and XhoI sites of the pGL expression vector using PCR-introduced ClaI and XhoI restriction sites [PMC6601510].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGCCCGAUGAUUAUAAAAAGACGCGUUAUUAAGAGGACUUUAUGCUGGAGUUCUUGACGUUUUUCUCUCUUUUCUAUACUUCUUUUUCUUUCUUUGAAUGUCCAGCGUCCUGUGAGCGAAGAUUAUGAGAUAUGAGGGCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications