Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 8 (SNORA8) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 8 (SNORA8) URS00003A960A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA8: SNORA8 is a small nucleolar RNA gene that is 137 nucleotides long [PMC6399517]. It is one of the genes that remain linked to splice and/or exonic variants [PMC6399517]. The SNP rs7936247, located in the region of histone modifications and regulated SNORA8 expression, has been associated with gestational diabetes mellitus (GDM) risk [PMC9035465]. SNORA8 has been predicted to be associated with the overall survival of cervical cancer patients [PMC8784813]. It has also been identified as one of the small nucleolar RNA genes that can be used to distinguish patients with cholangiocarcinoma (CCA) and primary sclerosing cholangitis (PSC) [PMC7140677]. SNORA8 belongs to a group of small nucleolar RNAs, including SNORD76, SNORD79, SNORD24, SNORD12B, SNORD68, SNORD11B, ZL11 from C/D snoRNAs and SNORA3, SNORA69, and SNORA31 from H/ACA snoRNAs that are differentially expressed in different conditions or diseases [PMC6294694]. In a study on gene expression in mouse liver cancer cells treated with a chemotherapeutic drug called 5-fluorouracil (5-FU), it was found that snoRNAs including SNORA8 were significantly downregulated or upregulated [PMC9321239]. Additionally, it has been identified as one of the potential biomarkers for the prognosis of kidney renal clear cell carcinoma (KIRC) [PMC9468637]. Furthermore, it has been found to be enriched in extracellular vesicles captured from different cell types [PMC5803193].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCACUGCAUGGUAUCUGCACUCAGCAGUUUACACCUGCUAGGGUGUUCAAAGGUCAGUGCUAUAGAAAUUCAGUAUCUGGCAUCGUUGGUUUUCUUGGCUUUGUGCUUGUUAAACCUGGUAUUUCUACUGAUACAGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications