Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 8 (SNORA8) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 8 (SNORA8) URS00003A960A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

snora8: SNORA8 is a small nucleolar RNA of the H/ACA box class, which is involved in the chemical modification of other RNAs, particularly ribosomal RNAs [PMC4159348]. Although the methodology in one study could not assess SNORA8 [PMC6399517], its expression has been linked to the SNP rs7936247, which is associated with gestational diabetes mellitus (GDM) risk [PMC9035465]. SNORA8 has also been identified as a potential biomarker for cervical cancer patient survival and has been associated with other long non-coding RNAs (lncRNAs) in this context [PMC8784813]. In addition, SNORA8 shows promise as a biomarker for distinguishing between cholangiocarcinoma (CCA) and primary sclerosing cholangitis (PSC), with high sensitivity and specificity indicated by its area under the curve (AUC) value [PMC7140677]. It is also one of several small nucleolar RNAs identified in extracellular vesicles (EVs), suggesting its potential role in intercellular communication [PMC5803193]. Furthermore, SNORA8 has been found to be significantly downregulated in certain datasets, highlighting its potential involvement in various biological processes and diseases [PMC9321239], and it is considered among potential prognostic biomarkers for kidney renal clear cell carcinoma (KIRC) [PMC9468637].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCACUGCAUGGUAUCUGCACUCAGCAGUUUACACCUGCUAGGGUGUUCAAAGGUCAGUGCUAUAGAAAUUCAGUAUCUGGCAUCGUUGGUUUUCUUGGCUUUGUGCUUGUUAAACCUGGUAUUUCUACUGAUACAGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression Publications