Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small nucleolar RNA, C/D box 15A (SNORD15A) URS00003A9200_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD15A: SNORD15A is a small nucleolar RNA (snoRNA) that is expressed at reduced levels in tissue from non-smokers compared to smokers [PMC9655370]. In a study using RNA-Seq, SNORD15A was identified as one of the significantly upregulated snoRNAs [PMC5514026]. Differential gene expression analysis revealed that SNORD15A was down-regulated by dietary restriction (DR) in male offspring, regardless of micronutrient supplementation [PMC4891691]. Although methylation of SNORD15A was observed in RiboMeth-seq data, there was no evidence of it acting as a guide at the methylation site [PMC5389715]. SNORD15A is predicted to target the nearby LSU-3764 using nucleotides upstream of box D [PMC5027482]. In a study involving various non-coding RNAs, SNORD15A was among the snoRNAs represented [PMC5747948]. Additionally, microarray data showed that RNASE5/FST strongly down-regulated SNORD15A in mouse mesodermal cells [PMC3733968]. SNORD15A is a snoRNA that has been implicated in various biological processes and has shown differential expression under different conditions. It may play a role in smoking-related effects on gene expression and could be influenced by dietary restriction and micronutrient supplementation. Further research is needed to fully understand the functional significance of SNORD15A and its potential involvement in different cellular processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUCGAUGAAGAGAUGAUGACGAGUCUGACUUGGGGAUGUUCUCUUUGCCCAGGUGGCCUACUCUGUGCUGCGUUCUGUGGCACAGUUUAAAGAGCCCUGGUUGAAGUAAUUUCCUAAAGAUGACUUAGAGGCAUUUGUCUGAGAAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications