Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1915-3p URS000039BFD2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1915: Hsa-mir-1915 is a microRNA that has been found to be downregulated in plasma samples of women with fetal Down syndrome (DS) syndrome [PMC9004059]. It is one of the miRNAs that are differentially expressed in maternal plasma obtained from T21 pregnancies, which suggests its potential as a noninvasive second-trimester prenatal screening marker [PMC8465311]. Hsa-mir-1915 has also been observed to be downregulated after treatment with EGCG [PMC5221119]. It has been identified as a differentially expressed miRNA in karyotypically abnormal human embryonic stem cells (hESC) after irradiation [PMC3275573]. Hsa-mir-1915 has been found to target the E2F2 gene, which is involved in transcriptional regulation and cell cycle control [PMC5221119]. Additionally, hsa-mir-1915 is one of the miRNAs that are upregulated in colorectal cancer cell lines [PMC8121855]. It is also present in the prediction database TargetScan, where it interacts with hsa-miR-371-5p and hsa-miR-134 [PMC4537452]. Overall, hsa-mir-1915 shows differential expression patterns and potential functional roles in various biological contexts [PMC9004059][PMC8465311][PMC5221119][PMC3275573][PMC8121855][PMC4537452].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCCAGGGCGACGCGGCGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications