Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Small Nucleolar RNA secondary structure diagram

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS0000398E29_559292

mRNA interactions 9 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACCAUAGUCUCGUGCUAGUUCGGUACUAUACAGGGAAGGGAAGUCACUCGCAUACGUGUGUGUGCAUUUCUUGCUAUUGCUGCUUAGCUUCUCUAAAACACUGGGCUAGCGUUUUUCAACGCUCGAGAGGCAGAGUCUCAAGGAGCCUCCAAUGGGCCUCACGUAUUCAUCUAGAUGGCGCUUCGGACAACGGCAUCACAUAAGAGAUGCAGCUCCUGACUUCUCCUCUGAUCUUCGUGAUCAGAGUUUUGAGUCGUCAGACUACGAGCAGUUUCUCUUAGUCGUUGCAUCGGGUGCUGUUGCCUUAACGAUGUGUAUAUGGGGUUCGGGGGCUGUUGCCAUGAUAUAUAUGGAUGAGACAGAAGUGGCCCCGUUGACGAGUUUAACUUAGAUUAAGUAGGACGCAUGAUCUUGAGCUCUUUUCCUAUACUUUGUCCUAUGGCCAGCUUUCUCCUUAUUACGAAGAGAUUGCGGGAUGUGGGUGCAGAGUGGGAAAAUCUGAGUUCGGUCAUCUUUGUUGUUCGUCCUACCGCAGUAUAUUCCUAAACACUAUGAAAUGACCCUAGUUGGUCCAUGAUCAUUUGGGUAAAACCAUACUGCAGACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Saccharomyces cerevisiae (baker's yeast) SNR30
  2. Saccharomyces cerevisiae YJM1133 SNR30
  3. Saccharomyces cerevisiae YJM1199 SNR30
  4. Saccharomyces cerevisiae YJM1202 SNR30
  5. Saccharomyces cerevisiae YJM1399 SNR30
  6. Saccharomyces cerevisiae YJM1478 SNR30
  7. Saccharomyces cerevisiae YJM1549 SNR30
  8. Saccharomyces cerevisiae YJM193 SNR30
  9. Saccharomyces cerevisiae YJM271 SNR30
  10. Saccharomyces cerevisiae YJM683 SNR30
2D structure Publications