Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Tupaia chinensis (Chinese tree shrew) tRNA secondary structure diagram

Tupaia chinensis (Chinese tree shrew) tRNA URS0000390F3A_246437

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCCUCCUAAGCCAGGGAUUGUGGGUUCGAGUCCCACCUGGGGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Ailuropoda melanoleuca tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  2. Balaenoptera acutorostrata scammoni tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  3. Bos taurus tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  4. Callithrix jacchus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  5. Callorhinchus milii tRNA-Arg (CCT) (tRNA-Arg-CCT-1 1 to 3)
  6. Canis lupus familiaris tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  7. Cavia porcellus tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1, tRNA-Arg-CCT-1-2)
  8. Ceratotherium simum simum tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  9. Chlorocebus sabaeus tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  10. Choloepus hoffmanni tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  11. Cricetulus griseus (Chinese hamster) tRNA
  12. Dasypus novemcinctus tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  13. Dipodomys ordii tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  14. Echinops telfairi tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  15. Eptesicus nilssonii tRNA-Arg
  16. Equus caballus tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  17. Erinaceus europaeus tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  18. Felis catus tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  19. Geospiza fortis tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  20. Gorilla gorilla gorilla tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  21. Heterocephalus glaber tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  22. Homo sapiens (human) tRNA-Arg (anticodon CCT) 2-1 (TRR-CCT2-1)
  23. Loxodonta africana tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  24. Macaca mulatta tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  25. Mesocricetus auratus (golden hamster) tRNA
  26. Microcebus murinus tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  27. Mus caroli tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1, tRNA-Arg-CCT-1-2)
  28. Mus musculus castaneus tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1, tRNA-Arg-CCT-1-2)
  29. Mus musculus domesticus tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1, tRNA-Arg-CCT-1-2)
  30. Mus musculus musculus tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1, tRNA-Arg-CCT-1-2)
  31. Mus musculus tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1, tRNA-Arg-CCT-1-2, tRNA-Arg-CCT-2-1, tRNA-Arg-CCT-2-2)
  32. Mus pahari tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  33. Mus spretus tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  34. Mustela putorius furo tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  35. Myotis brandtii tRNA
  36. Myotis davidii tRNA
  37. Myotis lucifugus tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  38. Neotoma lepida (desert woodrat) tRNA
  39. Nomascus leucogenys tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  40. Oryctolagus cuniculus tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  41. Otolemur garnettii tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  42. Ovis aries tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  43. Pan troglodytes tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  44. Papio anubis tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  45. Pongo abelii tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  46. Procavia capensis tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  47. Pteropus alecto (black flying fox) tRNA
  48. Rattus norvegicus tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  49. Saimiri boliviensis boliviensis tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  50. Trichechus manatus latirostris tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  51. Tursiops truncatus tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  52. Vicugna pacos tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
2D structure Publications