Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Ailuropoda melanoleuca tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 7) secondary structure diagram

Ailuropoda melanoleuca tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 7) URS000038D8D3_9646

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUAGUCGUGGCCGAGUGGUUAAGGCGAUGGACUAGAAAUCCAUUGGGGUCUCCCCGCGCAGGUUCGAAUCCUGCCGACUACG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 130 other species

  1. Acinetobacter baumannii tRNA-Ser
  2. Acropora cervicornis tRNA-Ser
  3. Albula glossodonta (roundjaw bonefish) tRNA-OTHER
  4. Albula goreensis tRNA-Ser
  5. Alligator mississippiensis tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1, tRNA-Ser-AGA-1-2)
  6. Alligator sinensis tRNA
  7. Alosa alosa tRNA-Ser
  8. Amazona aestiva tRNA
  9. Ameiurus melas (black bullhead) tRNA-Ser
  10. Anas platyrhynchos tRNA
  11. Anguilla anguilla (European eel) tRNA-Ser
  12. Anolis carolinensis tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 5)
  13. Apaloderma vittatum tRNA
  14. Aptenodytes forsteri (emperor penguin) tRNA
  15. Astyanax mexicanus (Mexican tetra) tRNA
  16. Balaenoptera acutorostrata scammoni tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 4)
  17. Bos taurus tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 8)
  18. Callipepla squamata tRNA
  19. Callithrix jacchus tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 6)
  20. Callorhinchus milii tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 3)
  21. Calypte anna tRNA
  22. Camelus ferus tRNA
  23. Canis lupus familiaris tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 6)
  24. Antrostomus carolinensis tRNA
  25. Carlito syrichta tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 4)
  26. Cavia porcellus tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 6)
  27. Ceratotherium simum simum tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 6)
  28. Cervus elaphus hippelaphus tRNA-Ser
  29. Chaetura pelagica tRNA
  30. Charadrius vociferus tRNA
  31. Chelonia mydas (green seaturtle) tRNA
  32. Chlorocebus sabaeus tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 6)
  33. Choloepus hoffmanni tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 5)
  34. Chrysemys picta bellii tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 3)
  35. Colinus virginianus (northern bobwhite) tRNA
  36. Columba livia tRNA
  37. Corvus brachyrhynchos (American crow) tRNA
  38. Cricetulus griseus tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 7)
  39. Cuculus canorus tRNA
  40. Danionella translucida tRNA-Ser
  41. Danio rerio tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 103)
  42. Dasypus novemcinctus tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 7)
  43. Desmophyllum pertusum tRNA-Ser
  44. Dipodomys ordii tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 5)
  45. Echinops telfairi tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 3)
  46. Eptesicus nilssonii tRNA-Ser
  47. Equus caballus tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 6)
  48. Erinaceus europaeus tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 6)
  49. Eurypyga helias tRNA
  50. Felis catus tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 7)
  51. Ficedula albicollis tRNA
  52. Fukomys damarensis tRNA
  53. Gallus gallus tRNA-Ser (AGA) (tRNA-Ser-AGA-2-1, tRNA-Ser-AGA-2-2)
  54. Gavia stellata tRNA
  55. Geospiza fortis tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1, tRNA-Ser-AGA-1-2)
  56. Gorilla gorilla gorilla tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 7)
  57. Heterocephalus glaber tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 3)
  58. Homo sapiens (human) tRNA-Ser (anticodon AGA) 2-1 (TRS-AGA2 1 to 6)
  59. Ictidomys tridecemlineatus tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 7)
  60. Lamprotornis superbus tRNA-OTHER
  61. Latimeria chalumnae tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1)
  62. Lepisosteus oculatus tRNA
  63. Lonchura striata domestica tRNA
  64. Loxodonta africana tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 5)
  65. Macaca mulatta tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 6)
  66. Manacus vitellinus tRNA
  67. Marmota monax (woodchuck) tRNA.Ser
  68. Megalops atlanticus tRNA-Ser
  69. Meleagris gallopavo tRNA-Ser (AGA) (tRNA-Ser-AGA-2-1, tRNA-Ser-AGA-2-2)
  70. Melopsittacus undulatus tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1)
  71. Mesocricetus auratus (golden hamster) tRNA
  72. Microcebus murinus tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 4)
  73. Monodelphis domestica tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 4)
  74. Mus caroli tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 6)
  75. Mus musculus castaneus tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 6)
  76. Mus musculus domesticus tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 6)
  77. Mus musculus musculus tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 8)
  78. Mus musculus tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 7)
  79. Mus pahari tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 7)
  80. Mus spretus tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 6)
  81. Mustela putorius furo tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 5)
  82. Myotis brandtii tRNA
  83. Myotis davidii tRNA
  84. Myotis lucifugus tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 5)
  85. Neotoma lepida (desert woodrat) tRNA
  86. Nestor notabilis tRNA
  87. Nipponia nippon tRNA
  88. Nomascus leucogenys tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 4)
  89. Notamacropus eugenii tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 4)
  90. Ochotona princeps tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 6)
  91. Ophiophagus hannah (king cobra) tRNA
  92. Orbicella faveolata (Mountainous star coral) tRNA-Ser
  93. Ornithorhynchus anatinus tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 3)
  94. Oryctolagus cuniculus tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 6)
  95. Otolemur garnettii tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 3)
  96. Ovis aries tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 8)
  97. Pangasianodon gigas tRNA-Ser
  98. Pangasianodon hypophthalmus tRNA-Ser
  99. Pangasius djambal tRNA-Ser
  100. Pan troglodytes tRNA-Ser (AGA) (tRNA-Ser-AGA-3 1 to 4, tRNA-Ser-AGA-3-6, tRNA-Ser-AGA-3-7)
  101. Papio anubis tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 6)
  102. Patagioenas fasciata monilis tRNA
  103. Pelecanus crispus tRNA
  104. Pelobates cultripes (western spadefoot toad) tRNA.Ser
  105. Pelodiscus sinensis (Chinese softshell turtle) tRNA
  106. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  107. Dryobates pubescens tRNA
  108. Pocillopora damicornis tRNA-Ser
  109. Podarcis lilfordi tRNA.Ser
  110. Pongo abelii tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 3)
  111. Procavia capensis tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 6)
  112. Pteropus alecto (black flying fox) tRNA
  113. Pygoscelis adeliae tRNA
  114. Rattus norvegicus tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 3)
  115. Saimiri boliviensis boliviensis tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 7)
  116. Sarcophilus harrisii tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 5)
  117. Scleropages formosus (Asian bonytongue) tRNA
  118. Sorex araneus tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 4)
  119. Sphaerodactylus townsendi tRNA-Ser
  120. Struthio camelus australis tRNA
  121. Sus scrofa tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 7)
  122. Taeniopygia guttata tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 3)
  123. Tauraco erythrolophus tRNA
  124. Tinamus guttatus tRNA
  125. Trichechus manatus latirostris tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 3)
  126. Tupaia chinensis (Chinese tree shrew) tRNA
  127. Tursiops truncatus tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 3)
  128. Vicugna pacos tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 4)
  129. Xenopus laevis (African clawed frog) tRNA
  130. Xenopus tropicalis tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 30)
2D structure Publications