Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Sarcophilus harrisii tRNA-Val (TAC) (tRNA-Val-TAC-2-1) secondary structure diagram

Sarcophilus harrisii tRNA-Val (TAC) (tRNA-Val-TAC-2-1) URS000038803E_9305

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUUCCAUAGUGUAGCGGUUAUCACGUCUGCUUUACACGCAGAAGGUCCUGGGUUCGAGCCCCAGUGGAACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 73 other species

  1. Alosa alosa (allis shad) tRNA-Val
  2. Ameiurus melas (black bullhead) tRNA-Val
  3. Astyanax mexicanus (Mexican tetra) tRNA
  4. Ataeniobius toweri tRNA-Val
  5. Balaenoptera acutorostrata scammoni tRNA-Val (TAC) (tRNA-Val-TAC-2-1)
  6. Bos taurus tRNA-Val (TAC) (tRNA-Val-TAC-4-1)
  7. Callithrix jacchus tRNA-Val (TAC) (tRNA-Val-TAC-2-1, tRNA-Val-TAC-2-2)
  8. Carlito syrichta tRNA-Val (TAC) (tRNA-Val-TAC-2-1, tRNA-Val-TAC-2-2)
  9. Cavia porcellus tRNA-Val (TAC) (tRNA-Val-TAC-2-1, tRNA-Val-TAC-2-2)
  10. Characodon lateralis tRNA-Val
  11. Chlorocebus sabaeus tRNA-Val (TAC) (tRNA-Val-TAC-3-1)
  12. Choloepus hoffmanni tRNA-Val (TAC) (tRNA-Val-TAC-3-1)
  13. Crenichthys baileyi tRNA-Val
  14. Cricetulus griseus tRNA-Val (TAC) (tRNA-Val-TAC-2-1, tRNA-Val-TAC-2-2)
  15. Dallia pectoralis tRNA-OTHER
  16. Danionella translucida tRNA-Val
  17. Danio rerio tRNA-Val (TAC) (tRNA-Val-TAC-10-1)
  18. Dipodomys ordii tRNA-Val (TAC) (tRNA-Val-TAC-2-1, tRNA-Val-TAC-2-2)
  19. Echinops telfairi tRNA-Val (TAC) (tRNA-Val-TAC-3-1)
  20. Erinaceus europaeus tRNA-Val (TAC) (tRNA-Val-TAC-2-1)
  21. Eschrichtius robustus tRNA-Val
  22. Fukomys damarensis tRNA
  23. Gasterosteus aculeatus tRNA
  24. Gorilla gorilla gorilla tRNA-Val (TAC) (tRNA-Val-TAC-3-1)
  25. Heterocephalus glaber tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  26. Hippoglossus stenolepis tRNA-Val
  27. Homo sapiens tRNA-Val (anticodon TAC) 2-1 (TRV-TAC2-1)
  28. Ictidomys tridecemlineatus tRNA-Val (TAC) (tRNA-Val-TAC-2-1, tRNA-Val-TAC-2-2)
  29. Larimichthys crocea tRNA
  30. Lepisosteus oculatus tRNA
  31. Loxodonta africana tRNA-Val (TAC) (tRNA-Val-TAC-3-1)
  32. Marmota monax (woodchuck) tRNA.Val
  33. Mesocricetus auratus (golden hamster) tRNA
  34. Microcebus murinus tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  35. Monodelphis domestica tRNA-Val (TAC) (tRNA-Val-TAC-2-1)
  36. Mus caroli tRNA-Val (TAC) (tRNA-Val-TAC-1 1 to 3)
  37. Mus musculus castaneus tRNA-Val (TAC) (tRNA-Val-TAC-1 1 to 3)
  38. Mus musculus domesticus tRNA-Val (TAC) (tRNA-Val-TAC-2-1, tRNA-Val-TAC-2-2)
  39. Mus musculus musculus tRNA-Val (TAC) (tRNA-Val-TAC-1 1 to 3)
  40. Mus musculus tRNA-Val (TAC) (tRNA-Val-TAC-1 1 to 4)
  41. Mus pahari tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  42. Mus spretus tRNA-Val (TAC) (tRNA-Val-TAC-1 1 to 3)
  43. Neotoma lepida (desert woodrat) tRNA
  44. Nomascus leucogenys tRNA-Val (TAC) (tRNA-Val-TAC-4-1)
  45. Nothobranchius furzeri tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  46. Ochotona princeps tRNA-Val (TAC) (tRNA-Val-TAC-3-1)
  47. Oreochromis niloticus tRNA-Val (TAC) (tRNA-Val-TAC-2-1, tRNA-Val-TAC-2-2)
  48. Oryctolagus cuniculus tRNA-Val (TAC) (tRNA-Val-TAC-2-1, tRNA-Val-TAC-2-2)
  49. Oryzias latipes tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  50. Otolemur garnettii tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  51. Ovis aries tRNA-Val (TAC) (tRNA-Val-TAC-3-1)
  52. Pangasianodon gigas tRNA-Val
  53. Pangasianodon hypophthalmus tRNA-Val
  54. Pangasius djambal tRNA-Val
  55. Pan troglodytes tRNA-Val (TAC) (tRNA-Val-TAC-3-1)
  56. Papio anubis tRNA-Val (TAC) (tRNA-Val-TAC-2-1)
  57. Pelobates cultripes (western spadefoot toad) tRNA.Val
  58. Pelodiscus sinensis tRNA
  59. Perca flavescens tRNA-Val
  60. Perca fluviatilis (European perch) tRNA-Val
  61. Poecilia formosa tRNA
  62. Pongo abelii tRNA-Val (TAC) (tRNA-Val-TAC-2-1)
  63. Procavia capensis tRNA-Val (TAC) (tRNA-Val-TAC-2-1)
  64. Rattus norvegicus tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  65. Saimiri boliviensis boliviensis tRNA-Val (TAC) (tRNA-Val-TAC-2-1)
  66. Salmo salar (Atlantic salmon) tRNA
  67. Sorex araneus tRNA-Val (TAC) (tRNA-Val-TAC-2-1)
  68. Sus scrofa tRNA-Val (TAC) (tRNA-Val-TAC-3-1)
  69. Takifugu rubripes tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  70. Tetraodon nigroviridis tRNA
  71. Tupaia chinensis tRNA
  72. Tursiops truncatus tRNA-Val (TAC) (tRNA-Val-TAC-2-1)
  73. Xiphophorus maculatus tRNA
2D structure Publications