Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mus spretus tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1) secondary structure diagram

Mus spretus tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1) URS000037D0FB_10096

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUAGUCGUGGCCGAGUGGUUAAGGCGAUGGACUUGAAAUCCAUUGGGGUUUCCCCGCGCAGGUUCGAAUCCUGCCGACUACG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 37 other species

  1. Ailuropoda melanoleuca tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  2. Bos taurus tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  3. Callithrix jacchus tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1, tRNA-Ser-TGA-2-2)
  4. Camelus ferus tRNA
  5. Ceratotherium simum simum tRNA-Ser (TGA) (tRNA-Ser-TGA-1 1 to 3)
  6. Cervus elaphus hippelaphus tRNA-Ser
  7. Chlorocebus sabaeus tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  8. Choloepus hoffmanni tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  9. Cricetulus griseus tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  10. Dipodomys ordii tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  11. Echinops telfairi tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  12. Equus caballus tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  13. Erinaceus europaeus tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  14. Fukomys damarensis (Damara mole-rat) tRNA
  15. Heterocephalus glaber tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  16. Homo sapiens tRNA-Ser (anticodon TGA) 2-1 (TRS-TGA2-1)
  17. Macaca mulatta tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  18. Mesocricetus auratus (golden hamster) tRNA
  19. Microcebus murinus tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  20. Monodelphis domestica tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  21. Mus caroli tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  22. Mus musculus castaneus tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  23. Mus musculus domesticus tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  24. Mus musculus tRNA-Ser (TGA) (tRNA-Ser-TGA-1 1 to 3, tRNA-Ser-TGA-2-1, tRNA-Ser-TGA-2-2)
  25. Notamacropus eugenii tRNA-Ser (TGA) (tRNA-Ser-TGA-1 1 to 3)
  26. Ochotona princeps tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  27. Oryctolagus cuniculus tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  28. Otolemur garnettii tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  29. Ovis aries tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
  30. Papio anubis tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  31. Pelobates cultripes tRNA.Ser
  32. Saimiri boliviensis boliviensis tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1, tRNA-Ser-TGA-2-2)
  33. Sarcophilus harrisii tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  34. Sus scrofa tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  35. Trichechus manatus latirostris tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  36. Xenopus laevis (African clawed frog) tRNA
  37. Xenopus tropicalis tRNA-Ser (TGA) (tRNA-Ser-TGA-1 1 to 15)
2D structure Publications