v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) RUNX2 antisense RNA 1 URS0000366D4F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

RUNX2-AS1: RUNX2-AS1 is an abundant exosomal long non-coding RNA (lncRNA) found in mesenchymal stem cells (MSCs) derived from patients with multiple myeloma (MM) [PMC8339964]. It has been discovered that RUNX2-AS1 can be transferred from MM cells to MSCs, leading to the inhibition of MSC osteogenesis by downregulating RUNX2 [Li B. et al., 2018]. This finding provides a novel pathological mechanism for the bone lesions observed in MM patients and suggests that targeting RUNX2-AS1 could be a potential therapeutic strategy in the future [PMC8339964]. RUNX2-AS1 is specifically enriched in MM-MSCs and is derived from the antisense strand of the RUNX2 gene. It forms an RNA duplex with RUNX2 premRNA through overlapping sequences [PMC8231946]. This interaction between RUNX2-AS1 and RUNX2 premRNA suggests a potential regulatory role of this lncRNA in modulating the expression of the transcription factor RUNX2, which is crucial for osteogenesis. The identification of this lncRNA provides new insights into the molecular mechanisms underlying bone lesions in MM and opens up possibilities for future therapeutic interventions targeting this pathway.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUGUUUCUCACACACAUCCAUGAGGGAAGAAUCAUUCCCAUUUAACAGACAAUGUAACUGGGCCUGAAUAUAGCUCAGCGACUUGCCCCAGGCCCACCAGGAAGUGGAUAAAGCCAUGCUCAACCCAGCACUUCUUCUCUCUACCUUCCACCGAUCCUGCCUGCUCAUCUUCCCUCCUUGGUGAAGGCAUGUGUGCUGUGCUCUGCUUAACUAAUUUCCCUCAGAUAUUCGCAUUUCUGUCUUUACAAUUUGGCAUCCCAGUGAGGUUUCCCUUUGUAUAUUUUCCGGUUCCUAUAUUCCCAUUAUUCAGGUAUCAUCACUCAAUAACCAUUUGACAGCAGUAAUGCUUUUCACAUGGAAAGAAUUGGGUUUUUAUUGAUGGCAAAUGUUGUGAUGAACUUUCAUGCCCACUUGGAGCCGGAGCACUUUUUUAUAGAAUGAACCACAAUGAGAAGCGUUUCCAAGAAAUGUCUUUGGAGUGUGGACUGAGAUGUACGUUUAGGAACAGGUCCUGUGGCCAGAGUGGGGAGAGAGGGGGCUUCCCAUUGUCAAAAUCUCAUCAAUCAAAAUGUAUAAUAGCAACAUUAUUAAUAACCCUAUAGUUGCAUUGCACUUGGUGCUCUUCCAAGCACUUCCCUAGAAUCCUAAAAUGAAGGCAGGGCAGAUAUUAUAUCCAUGUUACAGGUUAAACAACAUUGUAACAGGACUGAUAACACCAUGAAUGAGAAGUCAUUUGAUCAAUGGAGAGCCAGUUAUUAAACAUUUACCAACAUGUGCAAGAACGGGUUUCAAGGCCGAGGUGGGCAGAUCACAAGGUCAGGACUUUGAGACCAGCCUGGCCAAUAUGGUGAAACCCCAUUUCUACUAAAAAUACAAAAAAAUUAGCCAGGCGUGGUGAUGCAUGCCUGUAAUCCCAGCUACUCGGUAGGCUGAGGCAGGAGAAUUGCUUGAACCCGGGAGGCGGAGGUUUGCAGUGAGCCAAGAUCGCGCCACUGCACUCCAGCCUGGCAACAGAGCAAGACUCCGUCUCAAACAAAACACAGCACAACAAAACAAAAAAGAACGAGUUUCAUAGUGAGAAACAGCGGAGAAACCAGCUUACCUGGUGGGCCUUGAGUGGCCCCUACAAACUCCAACCUGUUCAAGACUCAUUUGCCACGUUGUACCUUCCAGCCAAGGCAAUCCCCCCAGCCUGAGCUACUUCCCAGACCAGACCACAGAAGCAAGGCCAUGCUCACCGAGGACCCCACUUGUGGACUAGACUUCUGUCCUGCUGUGGCCUCAAAAGCAAUAGCCAGGGCCCCAUGAUGAAGCUGCCAUCAGAAGCACAGGUGUGCCUGGCAAGGACACAGGAGGACCACGGCUCCAUGCCGAUGAGAAUGGCAGCUAAGUCUGAAGCUUUCUAUGAUUUAGAUUCCUGGUUGCGAGAGGGAGCCUAUAGGAAUGGCGAGAAGAGUGAGAACUUUGCAGAGGCAGCAAGGUGAGUUUAAACUGGAAACUAUGAAGUUCCUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications