Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 38A (SNORD38A) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 38A (SNORD38A) URS00003640C3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD38A: SNORD38A is a C/D box small nucleolar RNA (snoRNA) [PMC4052096]. It is annotated to SNORD46, RPS8, and SNORD38A [PMC4052096]. SNORD38A is highly expressed in control samples [PMC6125376]. It is associated with the number of tumor-infiltrating CD8 T cells [PMC8615616]. SNORD38A is one of the four genes that show strong GxE interactions and have single nucleotide variants (SNVs) within the proximal promoter [PMC4052096]. It plays a role in modifications of ribosomal RNA through 2′O-ribose methylation [PMC4052096]. SNORD38A has been found to be expressed at higher levels in extracellular vesicles from the HuH6 cell line compared to other cell lines [PMC5669939]. In Q fever seropositive controls, SNORD38A is down-regulated compared to healthy controls [PMC6518812]. It has been identified as one of the snoRNAs that can be used for the diagnosis of cervical cancer when combined with miRNAs and mRNAs [PMC9774372]. SNORD38A shows enrichment on the polypyrimidine tract (PPT) in splice sites analysis [PMC9226514]. In a normalization panel for microRNA analysis, SNORD38B and SNORD38A are used as small RNA controls for adjusting threshold crossing values between patient groups [PMC4519802].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCUCGUGAUGAAAACUCUGUCCAGUUCUGCUACUGAAGGGAGAGAGAUGAGAGCCUUUUAGGCUGAGGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications