Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) oar-miR-200c URS00003623B3_9940

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

oar-mir-200c: Oar-mir-200c, a member of the miR-200 family, is involved in epithelial-mesenchymal transition (EMT) [Mongroo and Rustgi, 2010; Pan et al., PMC6385976]. In a study on sheep, oar-mir-200c was selected for analysis to validate RNA-seq data [Pan et al., PMC6385976]. Competitive endogenous RNA network analysis revealed that oar-mir-200c targets circRNAs and is involved in various cellular processes [Pan et al., PMC9464909]. Specifically, oar_circ_0007583, oar_circ_0007584, and oar_circ_0007585 were identified as competitive endogenous RNAs of oar-mir-200c that affect the TGF-β signaling pathway and enhance somatic cell reprogramming efficiency in sheep [Pan et al., PMC9464909]. Functional experiments confirmed that oar-mir-200c directly targets the 3'UTR of ZEB1 gene and down-regulates its expression while increasing the expression of E-cadherin [Pan et al., PMC8611307]. Furthermore, luciferase assays demonstrated that co-transfection of oar-mir-200c mimics with ZEB1 3'UTR plasmids significantly decreased luciferase activity [Pan et al., PMC8611307]. In sheep somatic cell reprogramming experiments, transfection with oar-mir-200c mimics increased E-cadherin expression while decreasing ZEB1 expression [Pan et al., PMC8611307]. Additionally, bioinformatics analysis revealed that circRNA.18823, circRNA.688, and TCONS_00428946 mediate the regulation of FGF7 expression by oar-miR-200b and oar-mir-200c [Pan et al., PMC8427949]. The targets of oar-mir-200c were predicted using the miRbase and Target Scan platforms [Pan et al., PMC8611307]. The miRNAs oar-miR-150, oar-mir-200c, and oar-miR-152 were significantly enriched in epithelial development, immune response, and the Notch signaling pathway [Pan et al., PMC8427949].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAUACUGCCGGGUAAUGAUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Publications