Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Scyliorhinus torazame (cloudy catshark) Sto-Mir-22-P1a_3p (mature (guide)) URS000036025D_75743

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGCUGCCAGUUGAAGAGCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Callorhinchus milii (elephant shark) Cmi-Mir-22-P1a_3p (mature (guide))
  2. Cyprinus carpio ccr-miR-22b
  3. Danio rerio (zebrafish) dre-miR-22b-3p
  4. Gadus morhua Gmo-Mir-22-P1a_3p (mature (guide))
  5. Haplochromis burtoni abu-miR-22c
  6. Ictalurus punctatus (channel catfish) ipu-miR-22b
  7. Latimeria chalumnae Lch-Mir-22-P1a_3p (mature (guide))
  8. Lepisosteus oculatus Loc-Mir-22-P1a_3p (mature (guide))
  9. Maylandia zebra (zebra mbuna) mze-miR-22c
  10. Monopterus albus (swamp eel) Mal-Mir-22-P1a_3p (mature (guide))
  11. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-49873334
  12. Neolamprologus brichardi (lyretail cichlid) nbr-miR-22c
  13. Oreochromis niloticus (Nile tilapia) oni-miR-22c
  14. Pundamilia nyererei pny-miR-22c
  15. Salmo salar (Atlantic salmon) ssa-miR-22b-3p
  16. Takifugu rubripes fru-miR-22b
  17. Tetraodon nigroviridis tni-miR-22b
  18. Tor tambroides (Thai mahseer) miR-22b-3p