Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Apis florea (Dwarf honeybee) tRNA-Gln secondary structure diagram

Apis florea (Dwarf honeybee) tRNA-Gln URS000035EE7E_7463

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUCCCAUGGUGUAAUGGUUAGCACUCUGGACUUUGAAUCCAGCGAUCCGAGUUCAAAUCUCGGUGGGACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 243 other species

  1. Acromyrmex echinatior tRNA-Gln
  2. Acropora cervicornis tRNA-Gln
  3. Acropora millepora tRNA-Gln
  4. Adelges cooleyi (Spruce gall adelgid) transfer RNA glutamine (anticodon UUG)
  5. Agrilus planipennis tRNA-Gln
  6. Ailuropoda melanoleuca tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  7. Albula glossodonta tRNA-OTHER
  8. Albula goreensis tRNA-Gln
  9. Alligator mississippiensis tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  10. Amazona aestiva tRNA
  11. Amblyteles armatorius (Ichneumon Wasp) misc RNA ENSAAYG00000011492.1
  12. Ameiurus melas (black bullhead) tRNA-Gln
  13. Amyelois transitella tRNA-Gln
  14. Ancistrocerus nigricornis (Potter wasp) misc RNA ENSANRG00000003640.1
  15. Anguilla anguilla (European eel) tRNA-Gln
  16. Anolis carolinensis tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  17. Apis dorsata (Giant honeybee) tRNA-Gln
  18. Apis mellifera tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  19. Aplysia californica tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 10)
  20. Aromia moschata tRNA-Gln
  21. Astyanax mexicanus tRNA
  22. Ataeniobius toweri tRNA-Gln
  23. Athalia rosae (Coleseed sawfly) misc RNA ENSAEAG00005004799.1
  24. Atta cephalotes tRNA LOC105616953-2
  25. Atta colombica tRNA
  26. Balaenoptera acutorostrata scammoni tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  27. Bicyclus anynana (Squinting bush brown) tRNA-Gln
  28. Biomphalaria glabrata (Bloodfluke planorb) tRNA tRNA-Gln
  29. Biomphalaria pfeifferi tRNA-Gln
  30. Blattella germanica tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 11)
  31. Bombus huntii (Hunt's bumblebee) transfer RNA glutamine (anticodon UUG)
  32. Bombus terrestris tRNA LOC110119478
  33. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Gln
  34. Bombyx mandarina (Wild silkworm) tRNA-Gln
  35. Bombyx mori tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  36. Bos taurus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  37. Branchiostoma floridae tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  38. Callipepla squamata tRNA
  39. Callithrix jacchus tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1)
  40. Callorhinchus milii tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  41. Calypte anna (Anna's hummingbird) tRNA
  42. Camelus ferus tRNA
  43. Camponotus floridanus tRNA-Gln
  44. Canis lupus familiaris tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  45. Carlito syrichta tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  46. Cataglyphis hispanica (Desert ant) transfer RNA glutamine (anticodon UUG)
  47. Cavia porcellus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  48. Centruroides sculpturatus (Bark scorpion) tRNA-Gln
  49. Ceratotherium simum simum tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  50. Characodon lateralis tRNA-Gln
  51. Chelonia mydas tRNA
  52. Chelonus insularis tRNA-Gln
  53. Chelydra serpentina tRNA-Gln
  54. Chlorocebus sabaeus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  55. Choloepus hoffmanni tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  56. Vaccinia virus GLV-1h68 chr17.trna16-GlnTTG from Vaccinia virus GLV-1h68 (PDB 8C8H, chain U)
  57. Chrysemys picta bellii tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  58. Cimex lectularius (Bed bug) tRNA-Gln
  59. Cinara cedri tRNA.Gln
  60. Colinus virginianus tRNA
  61. Columba livia partial tRNA-Gln
  62. Cordylochernes scorpioides tRNA-Gln
  63. Crassostrea angulata (Portuguese oyster) transfer RNA glutamine (anticodon UUG)
  64. Crassostrea gigas tRNA-Gln for anticodon UUG
  65. Crassostrea virginica (Eastern oyster) tRNA-Gln
  66. Crenichthys baileyi tRNA-Gln
  67. Cricetulus griseus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  68. Cryptotermes secundus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  69. Cyphomyrmex costatus tRNA
  70. Daktulosphaira vitifoliae (Grape phylloxera) transfer RNA glutamine (anticodon UUG)
  71. Danaus plexippus plexippus tRNA
  72. Danionella translucida tRNA-Gln
  73. Danio rerio tRNA-Gln (TTG) (tRNA-Gln-TTG-4 1 to 3)
  74. Dasypus novemcinctus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  75. Dermacentor andersoni (Rocky Mountain wood tick) transfer RNA glutamine (anticodon UUG)
  76. Dermacentor silvarum (Tick) transfer RNA glutamine (anticodon UUG)
  77. Desmophyllum pertusum tRNA-Gln
  78. Diaphorina citri (Asian citrus psyllid) tRNA
  79. Dicentrarchus labrax (European seabass) transfer RNA-Gln
  80. Dipodomys ordii tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  81. Diuraphis noxia (Russian wheat aphid) tRNA-Gln
  82. Dryococelus australis tRNA-OTHER
  83. Dufourea novaeangliae tRNA-Gln
  84. Echinops telfairi tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  85. Eptesicus nilssonii tRNA-Gln
  86. Equus caballus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  87. Erinaceus europaeus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  88. Eufriesea mexicana tRNA-Gln
  89. Eumeta japonica tRNA-Gln
  90. Exocentrus adspersus tRNA-OTHER
  91. Felis catus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  92. Ficedula albicollis tRNA
  93. Frieseomelitta varia (marmelada) tRNA-Gln
  94. Gadus morhua tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  95. Galleria mellonella (Greater wax moth) tRNA-Gln
  96. Gallus gallus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  97. Gasterosteus aculeatus (three-spined stickleback) tRNA
  98. Gorilla gorilla gorilla tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  99. Habropoda laboriosa (Southeastern blueberry bee) tRNA-Gln
  100. Haliotis rubra (Blacklip abalone) tRNA-Gln
  101. Haliotis rufescens tRNA-Gln
  102. Harpegnathos saltator tRNA-Gln
  103. Heliconius melpomene tRNA HMEL014838
  104. Helicoverpa armigera transfer RNA glutamine (anticodon UUG)
  105. Helicoverpa zea tRNA-Gln
  106. Heterocephalus glaber tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  107. Hippoglossus stenolepis (Pacific halibut) tRNA-Gln
  108. Homalodisca vitripennis (Glassy winged sharpshooter) tRNA-Gln
  109. Homo sapiens tRNA-Gln (anticodon TTG) 1-1 (TRQ-TTG1-1)
  110. Hyalomma asiaticum tRNA-Gln for anticodon UUG
  111. Ichneumon xanthorius (Ichneumon Wasp) misc RNA ENSIXAG00005010634.1
  112. Ictidomys tridecemlineatus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  113. Ixodes persulcatus (Taiga tick) tRNA-Gln for anticodon UUG
  114. Ixodes scapularis tRNA-Gln
  115. Lamprotornis superbus tRNA-OTHER
  116. Larimichthys crocea tRNA
  117. Lasius niger tRNA
  118. Latimeria chalumnae tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  119. Leguminivora glycinivorella tRNA-Gln
  120. Lepisosteus oculatus (spotted gar) tRNA
  121. Limulus polyphemus (Atlantic horseshoe crab) tRNA-Gln
  122. Linepithema humile tRNA-Gln
  123. Lineus longissimus (Bootlace worm) misc RNA ENSLLNG00015025189.1
  124. Lingula anatina (Lamp shell) tRNA-Gln
  125. Lonchura striata domestica tRNA
  126. Loxodonta africana tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  127. Lupinus angustifolius (narrow-leaved blue lupine) tRNA
  128. Macaca mulatta tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  129. Macrosteles quadrilineatus (Aster leafhopper) transfer RNA glutamine (anticodon UUG)
  130. Manduca sexta tRNA-Gln
  131. Marmota monax tRNA.Gln
  132. Megachile rotundata tRNA-Gln
  133. Megalops atlanticus tRNA-Gln
  134. Meleagris gallopavo tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  135. Melipona bicolor tRNA-Gln
  136. Melipona quadrifasciata tRNA
  137. Melitaea cinxia misc RNA ENSMCXG00005023295.1
  138. Merluccius polli tRNA-Gln
  139. Mesocricetus auratus (golden hamster) tRNA
  140. Microcebus murinus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  141. Molorchus minor tRNA-OTHER
  142. Monodelphis domestica tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  143. Monomorium pharaonis (Pharaoh ant) tRNA-Gln
  144. Mus caroli tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  145. Mus musculus castaneus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  146. Mus musculus domesticus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  147. Mus musculus musculus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  148. Mus musculus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  149. Mus pahari tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  150. Mus spretus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  151. Mustela putorius furo tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  152. Myotis davidii tRNA
  153. Myotis lucifugus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  154. Nasonia vitripennis tRNA-Gln
  155. Nematostella vectensis (Starlet sea anemone) tRNA-Gln for anticodon UUG
  156. Neodiprion lecontei (Redheaded pine sawfly) tRNA-Gln
  157. Neodiprion pinetum (White pine sawfly) tRNA-Gln
  158. Neotoma lepida (desert woodrat) tRNA
  159. Nilaparvata lugens tRNA-Gln
  160. Nomascus leucogenys tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  161. Nothobranchius furzeri tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  162. Ochotona princeps tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  163. Onthophagus taurus tRNA-Gln
  164. Ooceraea biroi tRNA-Gln
  165. Operophtera brumata (winter moth) tRNA
  166. Orbicella faveolata tRNA-Gln
  167. Oreochromis niloticus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  168. Orussus abietinus tRNA-Gln
  169. Oryctes borbonicus tRNA
  170. Oryctolagus cuniculus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  171. Oryzias latipes tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  172. Ostrea edulis (European flat oyster) transfer RNA glutamine (anticodon UUG)
  173. Otolemur garnettii tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  174. Ovis aries tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  175. Pangasianodon gigas tRNA-Gln
  176. Pangasianodon hypophthalmus tRNA-Gln
  177. Pangasius djambal tRNA-Gln
  178. Pan troglodytes tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  179. Papilio machaon tRNA
  180. Papilio xuthus tRNA
  181. Papio anubis tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  182. Pararge aegeria tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  183. Patagioenas fasciata monilis tRNA
  184. Pectinophora gossypiella transfer RNA glutamine (anticodon UUG)
  185. Pediculus humanus corporis (Human body louse) tRNA tRNA-Gln
  186. Pelodiscus sinensis (Chinese softshell turtle) tRNA
  187. Perca flavescens (yellow perch) tRNA-Gln
  188. Perca fluviatilis (European perch) tRNA-Gln
  189. Dryobates pubescens tRNA
  190. Pleuronectes platessa (European plaice) tRNA-Gln
  191. Plutella xylostella tRNA-Gln
  192. Pocillopora damicornis (Cauliflower coral) tRNA-Gln
  193. Podarcis lilfordi tRNA.Gln
  194. Poecilia formosa tRNA
  195. Pogonomyrmex barbatus (Red harvester ant) tRNA-Gln
  196. Polistes canadensis (Red paper wasp) tRNA-Gln
  197. Polistes dominula (European paper wasp) tRNA-Gln
  198. Polistes fuscatus (Common paper wasp) tRNA-Gln
  199. Pomacea canaliculata (Apple snail) tRNA-Gln
  200. Pongo abelii tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  201. Potamilus streckersoni tRNA-Gln
  202. Procavia capensis tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  203. Pteropus alecto tRNA
  204. Rattus norvegicus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  205. Rhamnusium bicolor tRNA-Gln
  206. Rhipicephalus microplus tRNA-Gln
  207. Rhipicephalus sanguineus tRNA-Gln
  208. Rhodnius prolixus tRNA tRNA-Gln
  209. Rhopalosiphum maidis (Corn leaf aphid) tRNA-Gln
  210. Saccoglossus kowalevskii (Acorn worm) tRNA-Gln
  211. Saimiri boliviensis boliviensis tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  212. Schistocerca americana tRNA-Gln
  213. Schistocerca cancellata (South American locust) transfer RNA glutamine (anticodon UUG)
  214. Schistocerca gregaria (Grasshoppers) transfer RNA glutamine (anticodon UUG)
  215. Schistocerca nitens (Vagrant locust) transfer RNA glutamine (anticodon UUG)
  216. Schistocerca piceifrons (Central American locust) tRNA-Gln
  217. Schistocerca serialis cubense (Grasshoppers) transfer RNA glutamine (anticodon UUG)
  218. Scleropages formosus (Asian bonytongue) tRNA
  219. Sipha flava tRNA-Gln
  220. Solenopsis invicta (red fire ant) tRNA
  221. Sphaerodactylus townsendi tRNA-Gln
  222. Spodoptera frugiperda tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 3)
  223. Stegodyphus dumicola (Social spider) tRNA-Gln
  224. Strigamia maritima tRNA
  225. Stylophora pistillata tRNA-Gln
  226. Sus scrofa tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  227. Takifugu rubripes tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  228. Tetraodon nigroviridis tRNA
  229. Thrips palmi tRNA-Gln
  230. Tinamus guttatus tRNA
  231. Trachymyrmex cornetzi tRNA
  232. Trachymyrmex septentrionalis tRNA
  233. Trachymyrmex zeteki tRNA
  234. Trialeurodes vaporariorum tRNA-Gln for anticodon UUG
  235. Tribolium castaneum tRNA-Gln for anticodon UUG
  236. Trichechus manatus latirostris tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  237. Trichogramma pretiosum tRNA-Gln
  238. Trichomalopsis sarcophagae tRNA
  239. Tupaia chinensis (Chinese tree shrew) tRNA
  240. Venturia canescens tRNA-Gln
  241. Vicugna pacos tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  242. Xiphophorus maculatus (southern platyfish) tRNA
  243. Zootermopsis nevadensis tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 3)
2D structure