Spermophilus tridecemlineatus (thirteen-lined ground squirrel) U6 spliceosomal RNA

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Spermophilus tridecemlineatus (thirteen-lined ground squirrel) U6 spliceosomal RNA URS000035C796_43179

106 nucleotides
1 database (Rfam)
Found in 3 other species
33 publications
1. sncRNA
2. snRNA
3. u6 snRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GUGCUCGCUUCGGCAGCACAUAUACUAAAAUUGGAACGAUACAGAGAAGAUUAGCAUGGCCCCUGCGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Cervus elaphus hippelaphus ncRNA
Homo sapiens RNA, U6 small nuclear 1 (RNU6-1)
Mus musculus (house mouse) non-coding RNA

2D structure

Publications