Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-712-3p URS000034B3B5_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-712: Mmu-mir-712 is a miRNA located at ITS2 of the mouse rRNA gene (Rn45s) [PMC4969525]. It is considered a typical resident miRNA that does not require specific transcriptional factors or nucleases to exert its functions [PMC4969525]. Mmu-mir-712 has been identified as a negative regulator of tissue inhibitor of metalloproteinase 3 (TIMP3) expression [PMC6468398]. In murine models of atherosclerosis, neutralizing mmu-mir-712 by anti-miR-712 rescues TIMP3 expression and prevents disease progression [PMC6468398]. Mmu-mir-712 has also been reported to play roles in endothelial inflammation and atherosclerosis [PMC4338334]. In DIO mice, mmu-mir-712, along with other miRNAs, was found to be upregulated [PMC4571067]. The binding of mmu-mir-712 might be affected by the ss410758894 polymorphism, with the minor A allele showing less similarity to the miRNA-binding site [PMC3394711]. Mmu-mir-712 is derived from pre-ribosomal RNA by exoribonucleases involved in pre-rRNA maturation [PMC6070170]. It has been shown that mmu-mir-712 derived from pre-ribosomal RNA induces endothelial inflammation and atherosclerosis [PMC4261535]. The mature forms of mmu-mir-712 are mmu-miR-712-5p and mmu-miR-7123p, but their coding genes' locations are still uncertain and their function unknown [PMC4261535].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCGAGUCACCCCCGGGUGUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications