Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 9 (SNORA9) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 9 (SNORA9) URS000033FC0E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA9: SNORA9 is a small nucleolar RNA (snoRNA) that has been studied in various contexts [PMC6721724]. Exogenously expressed PARN, a poly(A)-specific ribonuclease, has been shown to slightly increase the RNA levels of SNORA9 [PMC6721724]. SNORA9 has also been identified as a substrate of PARN in the nucleus [PMC6721724]. However, no changes in SNORA9 expression were observed in certain experiments [PMC6480895]. This suggests that the designed siRNAs target SNHG15 exons after splicing, leaving intact SNORA9 for independent study of SNHG15 function [PMC6480895]. Additionally, two guide RNAs (gRNAs) were designed to delete a region of SNHG15 without affecting the sequence of SNORA9 [PMC6480895]. In another study, miRNA and snoRNA expression analysis revealed that SNORA9 was significantly altered in H19-expressing LFS osteoblasts [PMC7844330]. Furthermore, SNORA9 was found to be involved in the ceRNA network and identified as one of 12 lncRNAs with regulatory roles [PMC7859920]. In various contexts and experiments, small nucleolar RNAs (snoRNAs) including SNORA9 have been shown to be differentially expressed and potentially involved in cellular signaling and translation initiation processes [PMC5747948] [PMC6020320] [PMC6054847] [PMC8971550]. Specifically, DLGAP5, LOC105379355, PADI6, and SNORA9 were found to be top specifically expressed transcripts in ovarian tissues related to PCOS [PMC8971550]. Additionally, snoRNAs including H/ACA box snoRNA SNORA9 have been found to be upregulated in certain conditions or diseases such as PCOS or cancer cells [PMC7753709].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCAAGCCUCCAGCGUGCUUGGGUCUGCGGUGACCCUAUGCAUUCCUUCAGUGCUUGCUAGAACAGUUUUGAAACGGUUUGAGGCCUUGCCCUGCUCCAUCCAGAGCAAGGUUAUAGAAAUUUCAGACAAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications