Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-218 precursor URS0000332092_9509

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCGAGGUAUGAGUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 39 other species

  1. Aotus nancymaae miRNA (ENSANAG00000015303.1)
  2. Carlito syrichta miRNA (ENSTSYG00000021683.2)
  3. Cavia aperea microRNA 218-1 (ENSCAPG00000003275.1)
  4. Cavia porcellus (domestic guinea pig) microRNA 218-1 (ENSCPOG00000016184.3)
  5. Cebus imitator (Panamanian white-faced capuchin) microRNA 218-1 (ENSCCAG00000003290.1)
  6. Choloepus hoffmanni (Hoffmann's two-fingered sloth) microRNA 218-1 (ENSCHOG00000015405.1)
  7. Cricetulus griseus (Chinese hamster) miRNA (ENSCGRG00000021276.1, ENSCGRG00001002037.1, ENSCGRG00015018980.2)
  8. Fukomys damarensis (Damara mole rat) miRNA (ENSFDAG00000004125.1)
  9. Gorilla gorilla gorilla ggo-mir-218 (ENSGGOG00000032967.2)
  10. Gorilla gorilla microRNA ggo-mir-218 precursor
  11. Heterocephalus glaber miRNA (ENSHGLG00100024161.2)
  12. Homo sapiens (human) microRNA hsa-mir-218 precursor (hsa-mir-218-1)
  13. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA 218-1 (ENSSTOG00000016673.1)
  14. Lagothrix lagotricha (brown woolly monkey) microRNA lla-mir-218 precursor (lla-mir-218-1)
  15. Marmota marmota marmota (Alpine marmot) microRNA 218-1 (ENSMMMG00000017054.1)
  16. Meriones unguiculatus (Mongolian gerbil) miRNA (ENSMUGG00000022404.1)
  17. Mesocricetus auratus microRNA 218-1 (ENSMAUG00000005982.1)
  18. Microtus ochrogaster (vole) microRNA 218-1 (ENSMOCG00000008478.1)
  19. Nannospalax galili microRNA 218-1 (ENSNGAG00000006675.1)
  20. Nomascus leucogenys microRNA 218-1 (ENSNLEG00000019669.2)
  21. Oryctolagus cuniculus microRNA 218-1 (ENSOCUG00000019075.1)
  22. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-218 precursor (ppa-mir-218-1)
  23. Pan troglodytes (chimpanzee) microRNA ptr-mir-218 precursor (ptr-mir-218-1)
  24. Peromyscus maniculatus bairdii microRNA 218-1 (ENSPEMG00000006031.2)
  25. Pongo abelii (Sumatran orangutan) miRNA (ENSPPYG00000021756.2)
  26. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-218 precursor (ppy-mir-218-1)
  27. Saguinus labiatus (red-chested mustached tamarin) microRNA sla-mir-218 precursor (sla-mir-218-1)
  28. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000036370.1)
  29. Sciurus vulgaris microRNA 218-1 (ENSSVLG00005017676.1)
  30. Spermophilus dauricus miRNA (ENSSDAG00000005006.1)
  31. Tupaia belangeri microRNA 218-1 (ENSTBEG00000017934.1)
  32. Urocitellus parryii microRNA 218-1 (ENSUPAG00010017899.1)