Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cervus elaphus (red deer) cel-miR-411a-3p URS0000330D08_9860

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUGUAACACGGUCCACUAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Capra hircus (goat) chi-miR-411a-3p
  2. Cavia porcellus (domestic guinea pig) cpo-miR-411-3p
  3. Dasypus novemcinctus dno-miR-411-3p
  4. Macaca mulatta mml-miR-411-3p
  5. Mus musculus (house mouse) Mmu-Mir-154-P13_3p (mature (co-guide))
  6. Oryctolagus cuniculus (rabbit) ocu-miR-411-3p
  7. Ovis aries (sheep) oar-miR-411a-3p
  8. Pteropus alecto pal-miR-411-3p