v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
HIV-1 REVERSE TRANSCRIPTION PRIMER TRNA(LYS3) from Bos taurus (PDB 1FIR, chain A) secondary structure diagram

HIV-1 REVERSE TRANSCRIPTION PRIMER TRNA(LYS3) from Bos taurus (PDB 1FIR, chain A) URS000032F6AC_9913

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCCCGGAUAGCUCAGUCGGUAGAGCAUCAGACUUUUAAUCUGAGGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Homo sapiens (human) tRNA-Lys
  2. Mus musculus (house mouse) transfer RNA-Lys
  3. Oryctolagus cuniculus tRNA Lys 3UU
  4. Rattus norvegicus tRNA Lys 3UU
 2D structure Publications