v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
E-site tRNA from Giardia lamblia ATCC 50803 (PDB 8BR8, chain Lu) secondary structure diagram

E-site tRNA from Giardia lamblia ATCC 50803 (PDB 8BR8, chain Lu) URS0000326EAC_184922

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGCAGAGUGGCGCAGCGGAAGCGUGCUGGGCCCAUAACCCAGAGGUCGAUGGAUCGAAACCAUCCUCUGCUACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Mus musculus Met-tRNA from Mus musculus (PDB 7CPV, chain S6)
  2. Oncorhynchus keta tRNA-Met
  3. Homo sapiens P/E tRNA from Homo sapiens (PDB 6Y57, chain B4)
  4. Oryctolagus cuniculus P/E tRNA from Oryctolagus cuniculus (PDB 6HCJ, chain 33)
  5. Salmo salar tRNA Ini CAU
  6. Giardia intestinalis tRNA from Giardia intestinalis (PDB 8BSJ, chain u)
  7. Xenopus laevis tRNA Ini CAU
 2D structure