Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) Hsa-Mir-2355_3p (mature (co-guide)) URS0000306FCC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-2355: Hsa-mir-2355 is a microRNA that has been found to promote cell proliferation and invasion when overexpressed [PMC7794682]. It has been identified as a potential target for the ENTPD5 and NT5C3A genes [PMC7794682]. The expression of hsa-mir-2355 was found to be higher in nonresponder samples of HNSC and CESC subgroups [PMC7794682]. In a miRNA signature analysis, hsa-mir-2355 was one of the 23 miRNAs identified, and it was significantly associated with prognosis in patients with HCC [PMC7467934]. Interactions between hsa-mir-2355 and 10 lncRNAs were also observed [PMC9307901]. The expression of hsa-mir-2355 was downregulated in astrocytes exposed to cocaine, HIV-1 Tat, and TC [PMC9307901]. In another study, hsa-mir-2355 was one of the significantly altered miRNAs identified along with H19, HHIP-AS1, NOP14-AS1, NDUFA9, and LIPG genes [PMC7393356]. The effects of HIV-1 Tat and cocaine coexposure on hsa-mir-2355 were investigated in this study as well [PMC7393356]. Additionally, the expression level of hsa-mir-2355 was downregulated following MG induction [PMC7393356].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUCCUUGCUGUUUGGAGAUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Cavia porcellus cpo-miR-2355-3p
Publications