Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR166j-5p URS0000304BCB_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR166j-5p: Osa-mir166j-5p is a microRNA that has been found to be differentially expressed in rice upon R. solani infection [PMC9189367]. In various studies, osa-mir166j-5p has been shown to be downregulated in response to chilling stress [PMC9002458], R. solani infection [PMC7662745], and different strains of R. solani [PMC7662745]. It is a member of the miR166 family, along with osa-miR166h-3p, osa-miR166g-3p, osa-miR166k-3p, and osa-miR166l-3p [PMC9002458]. Osa-mir166j-5p has been found to have different expression patterns and roles compared to other miRNAs in the same family [PMC9002458]. Osa-mir166j-5p has also been shown to be differentially regulated at different time points during R. solani infection, with downregulation at early time points and upregulation at later time points [PMC7662745]. The target gene of osa-mir166j-5p, a subtilisin-like protease gene, showed upregulation in one rice cultivar but downregulation in others upon R. solani infection [PMC7662745]. Overall, these findings suggest that osa-mir166j-5p plays a role in response to chilling stress and R. solani infection in rice.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAAUGACGUCCGGUCUGAAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR166j-5p
Publications