Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000013087.1) secondary structure diagram

Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000013087.1) URS0000302909_61622

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGUGCUUUCAGCUUCUUUACAGUGCUGCCUUGUAGCAUUCAGGUCAAGCAGCAUUGUACAGGGCUAUGAAAGAACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Aotus nancymaae miRNA (ENSANAG00000009820.1)
  2. Callithrix jacchus (white-tufted-ear marmoset) mir-103/107 microRNA precursor
  3. Cavia porcellus (Domestic guinea pig) mir-103/107 microRNA precursor
  4. Cebus imitator (Panamanian white-faced capuchin) microRNA 103a-2 (ENSCCAG00000012404.1)
  5. Cercocebus atys miRNA (ENSCATG00000020310.1)
  6. Chlorocebus sabaeus microRNA 103a-2 (ENSCSAG00000026792.1)
  7. Choloepus hoffmanni (Hoffmann's two-fingered sloth) miRNA (ENSCHOG00000014205.1)
  8. Colobus angolensis palliatus miRNA (ENSCANG00000019272.1)
  9. Eptesicus fuscus mir-103/107 microRNA precursor
  10. Erinaceus europaeus miRNA (ENSEEUG00000015989.1)
  11. Fukomys damarensis (Damara mole-rat) mir-103/107 microRNA precursor
  12. Gorilla gorilla gorilla microRNA 103a-2 (ENSGGOG00000030174.2)
  13. Heterocephalus glaber mir-103/107 microRNA precursor
  14. Homo sapiens microRNA hsa-mir-103a precursor (hsa-mir-103a-2)
  15. Macaca mulatta microRNA mml-mir-103 precursor (mml-mir-103-2)
  16. Macaca nemestrina miRNA (ENSMNEG00000010628.1)
  17. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000022297.1)
  18. Marmota monax (woodchuck) non-coding RNA
  19. Microcebus murinus (gray mouse lemur) microRNA 103a-2 (ENSMICG00000037881.2)
  20. Myotis brandtii mir-103/107 microRNA precursor
  21. Myotis davidii mir-103/107 microRNA precursor
  22. Myotis lucifugus microRNA 103a-2 (ENSMLUG00000018081.1)
  23. Otolemur garnettii miRNA (ENSOGAG00000017569.1)
  24. Pan paniscus (bonobo) microRNA 103a-2 (ENSPPAG00000008452.1)
  25. Pan troglodytes ptr-mir-103-2 (ENSPTRG00000027592.3)
  26. Papio anubis (Olive baboon) mir-103/107 microRNA precursor
  27. Pongo abelii (Sumatran orangutan) mir-103/107 microRNA precursor
  28. Pongo pygmaeus microRNA ppy-mir-103 precursor (ppy-mir-103-2)
  29. Propithecus coquereli miRNA (ENSPCOG00000002824.1)
  30. Pteropus alecto (black flying fox) mir-103/107 microRNA precursor
  31. Pteropus vampyrus microRNA 103a-2 (ENSPVAG00000025316.1)
  32. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000017423.1)
  33. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000003316.1)
  34. Ictidomys tridecemlineatus mir-103/107 microRNA precursor
2D structure