Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-511-3p URS00002FCE92_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-511: Mmu-mir-511 is a microRNA that was analyzed using qPCR and specific assays [PMC4551340]. A precursor miRNA expression clone for mmu-mir-511 was obtained from GeneCopoeia, along with a scrambled control clone [PMC4551340]. Pre-miR™ miRNA Precursors for mmu-mir-511 were purchased from Ambion [PMC4551340]. While mmu-mir-511 was not detectable in N2a cells, hsa-miR-511 was expressed in HEK293 cells [PMC4023888]. Taqman microRNA assays were used to detect hsa-miR-511, hsa-miR-4711-3p, or mmu-mir-511 [PMC4023888]. Mmu-mir-511 has a perfect seed match to the mouse 3′UTR, while hsa-miR-511 perfectly matches the human 3′UTR carrying the T allele [PMC4023888]. The seed sequence of mouse mmu-mir-511 differs from hsa-miR-511 at the nucleotide complementary to the SNP position [PMC4023888]. Mmu-mir-511 is regulated by GR dimer transactivation and downregulates TNFR1 expression [PMC8870481]. References: [PMC4551340] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4551340/ [PMC4023888] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4023888/ [PMC8870481] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8870481/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUGUGUAGCAAAAGACAGGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications