Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 2A (SNORA2A) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 2A (SNORA2A) URS00002E5E66_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA2A: SNORA2A is a small nucleolar RNA (snoRNA) that is highly expressed in metastatic breast cancer patients and cell lines [PMC8445368]. SnoRNAs with similar sequences are given the same name with a differing suffix [PMC8178906]. SNORA2A was identified as a highly expressed transcript in sentinel lymph node metastasis [PMC5747948]. It is one of the snoRNAs that are upregulated in G0 cells and its overexpression leads to increased eIF2α phosphorylation [PMC9616492]. SNORA2A is also identified as one of the high survival markers in pediatric patients [PMC6438000]. Additionally, SNORA2A is commonly downregulated in stable and transient overexpression cells [PMC9135243]. References: - [PMC8445368]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8445368/ - [PMC8178906]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8178906/ - [PMC5747948]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5747948/ - [PMC9616492]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9616492/ - [PMC6438000]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6438000/ - [ PMC9135243]: https://www.ncbi.nlm.nih.gov/pmc/articles/ PMC9135243/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGGCCCUGAAUCAAGACCAAUGGUUUGCUGUAGCUGUUGGUUUCAAACAGGAGCUAAGAGUGAUGUCUUCCUUGUGGUCUGUUGGCUAUUCAGUAUUCCAGUGCGAAUUGCCAAUUCAGUUGGAAGAAACAUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications