Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1270 URS00002E0524_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1270: Hsa-mir-1270, a microRNA, has been shown to have a significant suppressive effect on glioblastoma multiforme (GBM) in in vivo xenograft models [PMC6592694]. The targets of hsa-mir-1270 and hsa-miR-3177-5p are enriched for alternative splicing, suggesting their potential role in regulating gene expression [PMC8158476]. The upregulation of hsa-mir-1270 has been found to have a significant impact on GBM, indicating its potential as a therapeutic target for this aggressive brain tumor [PMC6592694]. Additionally, the enrichment of alternative splicing targets suggests that hsa-mir-1270 and hsa-miR-3177-5p may play a role in modulating gene expression through this mechanism [PMC8158476]. These findings contribute to our understanding of the molecular mechanisms involved in GBM and provide potential avenues for therapeutic intervention. Further research is needed to elucidate the specific genes and pathways regulated by hsa-mir-1270 and its impact on GBM progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGGAGAUAUGGAAGAGCUGUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications