Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Saccharomyces cerevisiae S288C RNA of Unknown Function URS00002DAFB5_559292

Genome locations

Gene Ontology annotations

Localisation

No annotated location

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACAAAGUAUCUAAACAAAAUACAUAAGUGUACUCAAACUGAGUAGAAUCGUCGAUUAAACUUCCUUCUCCUUUUAAAAAUUAAAAACAGCAAAUAGUUAGAUGAAUAUAUUAAAGACUAUUCGUUUCAUUUCCCAGAGCAGCAUGACUUCUUGGUUUCUUCAGACUUGUUACCGCAGGGGCAUUUGUCGUCGCUGUUACACCCCGUUGGGCAGCUACAUGAUUUUUGGCAUUGUUCAUUAUUUUUGCAGCUACCACAUUGGCAUUGGCACUCAUGACCUUCAUUUUGGAAGUUAAUUAAUUCGCUGAACAUUUUAUGUGAUGAUUGAUUGAUUGAUUGUACAGUUUGUUUUUCUUAAUAUCUAUUUCGAUGACUUCUAUAUGAUAUUGCACUAACAAGAAGAUAUUAUAAUGCAAUUGAUACAAGACAAGGAGUUAUUUGCUUCUCUUUUAUAUGAUUCUGACAAUCCAUAUUGCGUUGGUAGUCUUUUUUGCUGGAACGGUUCAGCGGAAAAGACGCAUCGCUCUUUUUGCUUCUAGAAGAAAUGCCAGCAAAAGAAUCUCUUGACAGUGACUGACAGCAAAAAUGUCUUUUUCUAACUAGUAACAAGGCUAAGAUAUCAGCCUGAAAUAAAGGGUGGUGAAGUAAUAAUUAAAUCAUCCGUAUAAACCUAUACACAUAUAUGAGGAAAAAUAAUACAAAAGUGUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Saccharomyces cerevisiae RUF5-1
  2. Saccharomyces cerevisiae YJM1133 RUF5-2
  3. Saccharomyces cerevisiae YJM1208 RUF5-1
  4. Saccharomyces cerevisiae YJM1250 RUF5-1
  5. Saccharomyces cerevisiae YJM1383 RUF5-2
  6. Saccharomyces cerevisiae YJM1385 RUF5-2
  7. Saccharomyces cerevisiae YJM1386 RUF5-2
  8. Saccharomyces cerevisiae YJM1443 RUF5-2
  9. Saccharomyces cerevisiae YJM1615 RUF5-2
  10. Saccharomyces cerevisiae YJM428 RUF5-1
  11. Saccharomyces cerevisiae YJM541 RUF5-2
  12. Saccharomyces cerevisiae YJM682 RUF5-2
  13. Saccharomyces cerevisiae YJM683 RUF5-1
  14. Saccharomyces cerevisiae YJM689 RUF5-1
Publications