Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo pygmaeus (Bornean orangutan) microRNA mir-203 URS00002CBE8B_9600

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGCGCUGGGUCCAGUGGUUCUUAACAGUUCAACAGUUCUGUAGCGCAAUUGUGAAAUGUUUAGGACCACUAGACCCGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Ailuropoda melanoleuca microRNA mir-203
  2. Chlorocebus sabaeus microRNA mir-203
  3. Felis catus (domestic cat) microRNA mir-203
  4. Gorilla gorilla gorilla microRNA mir-203
  5. Homo sapiens microRNA mir-203
  6. Macaca mulatta microRNA mir-203
  7. Nomascus leucogenys microRNA mir-203
  8. Papio anubis microRNA mir-203
  9. Pongo abelii microRNA mir-203
Publications