Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4435 URS00002BBA1C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4435: Hsa-mir-4435 is a microRNA (miRNA) implicated in various biological processes and diseases, including breast cancer and hepatocellular carcinoma (HCC) [PMC8158160; PMC9820840]. In breast cancer, hsa-mir-4435 was identified as a potential prognostic biomarker, as its dysregulation was significantly related to the overall survival (OS) of patients [PMC8158160]. However, hsa-mir-4435 did not show differential expression between cancerous and paired paracancerous tissues in breast cancer patients [PMC8158160]. Additionally, hsa-mir-4435 was not evaluated in the comparison of expression levels between high and low metastatic cell lines due to a lack of data [PMC8158160]. In the context of multiple sclerosis (MS), hsa-mir-4435 expression is specific to B cells and not expressed in lymphoblastoid cell lines (LCLs), suggesting its context-specific regulatory role [PMC8000127]. Furthermore, hsa-mir-4435 targets several disease-related genes, indicating its regulatory importance in disease progression such as diabetic retinopathy (DR) [PMC8545528]. The host gene of hsa-mir-4435 is MIR4435-2HG, which contains several single nucleotide polymorphisms (SNPs) within transcription factor binding sites (TFBS), suggesting potential regulatory mechanisms at the genetic level [PMC8545528]. Hsa-mir-4435 has also been associated with pregnancy complications, indicating its role beyond oncology into reproductive health [PMC8539647].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGGCCAGAGCUCACACAGAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

Publications