v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 273 (LINC00273) URS00002B9FE9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00273: LINC00273 is a long non-coding RNA (lncRNA) that has been studied in the context of cancer metastasis. Research has shown that the interchange of exosomes can affect the functions and phenotypes of lung adenocarcinoma (LUAD) cells and macrophages, and this process is mediated by exosomal miR‐19b‐3p and LINC00273 [PMC8435259]. Knockdown of LINC00273 has been found to significantly inhibit the colony formation capability of ovarian cancer cells [PMC9652518]. Furthermore, the positive role of LINC00273 in cancer metastasis has been confirmed by studying its mRNA expression in various normal, benign, and malignant clinical samples from different tissues [PMC5746379]. It has been observed that M2 macrophages can inhibit the transcription of LINC00273 by arresting a G-quadruplex structure in its promoter region, which contributes to their anti-metastatic effect [PMC5746379]. Additionally, histone acetylation has been found to regulate the expression of LINC00273 and another gene called KDM1B [PMC9220252]. Inhibition of histone acetyltransferase p300 (si-p300 HAT) and acetyl-CoA carboxylase (si-ACL) prevents transcriptional increases in expression of both LINC00273 and KDM1B [PMC9220252]. These findings highlight the importance of LINC00273 in cancer metastasis and suggest potential therapeutic targets for intervention.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCAAGUAGGUAGAAAGCGGCCUCCAGGCCUCGCGAGGAUGAGCCCGGCGUCCCAGUCGCGAGGAUGGGCGCGGCAGGGCGGGCGACCCGGCUUGUGGGAGGGAGGGAGCAGCGCGGGGCGGUGGGAGGGGGGUGGUGGGGCGGCGAACCGGACAUCCCAUACACCCACACUACAGAACACCCCCCGAUGGGCUCACCACUCCCGAACCUUCGCGCCCACGUGCGAACAGGCAGACCGCCCGACCCGUGCACGGCAGCUGCGAGGGACCGGCGGCCACUCGGGCGUGGCGGGCGCGGGGCAGCCCAGACGUUUGGGCAGCGAACCAGAGGCGGACCGCGGUGCCCGGGAUCUCACCGCCAGCGGCCUCCAAGCAUGAAGGCGGCCCCGCGGCUCCCCCACCGCCUCCGCCAUCGCGGCCAGCCCCCGGAACCCUCUUCCCUGCGCGCGCUGCACGCCGACCCCAUACCCUCCGGGCUCUCACCAGGCCCAUGCGGAGCGCCGCCGACCUGGUCCGGAAGGCGCGCGCCCGGGGACAGGGACAACCGGCCAACCAGUGGCCCGUGGCAGCGCCACACAAGGCGGAGCCGGGUUUGGUCCCAGAGGGGGCCACCACAGCCUAAGCUGGUGAGCCGCUCGGGGAGAGAGGAUACGCGGGCGGGGAGGGGGGCACAGACAGGCAAGGCCAGGGACCGCAAGGGCAAGGGCACCCGGGAGCCCGCAGAGGGGCGGCUCGGGAAGAAACCUCAGGCAAAGCCGGGCCACCAGGAAAACACGGCCACGGGAUCCCACCGCCACAGAUACGAGGGAGGUCCCGCGGCGCCCCGCCUAGGAAGCCGGACGGCCCCUGGCACCCACCGAGACCCGCCUCACGAGCCUGGGUCCCGCCAUCGGGACCCCGAAGCGACCUCAGCCACAAACCCAACGCCAGGGCCACGUUGCUGGUUUCUUGUCCAUCCUCCGACACUGUCAAGCUCCGGGAGACCGGCGCGCCCCCCACUUGGGAUGCUUCCCAUGGCCAGGCAUCCCAACCCCGUGCCACGCAAACGCGGUUGUCGGCACCGGUCGCUGCUCCUCAGGGGAGCGGGUGGAGAGCCGGCUCGCAGCGGAGCGGGUCACGCGCCGGACGGAACGCCUGGCACAGCCACCGCUCGCGCAGCCUCCCAACCGCUAGGACGCCGGCCCGGCCCGGCGGGAUCCUCCCCCGACUCGGAAGGGGGAGGCGCGGGCCACACAGUAGGUGACGAGCCGCCCUCGGUCCCCACCGCGGAGGACUCUCUCAAGAGAGAGUCGGUAAGAGACUCAUCAUUCUCUCCCGAAAGCAGUGAGGUGGAUGGUGGCUUGUGUUCCGAGCUCCUGUGGUUUCAGUUGGCCGCGCGUAGAAGAGAGAUUUCCAAUGUUUCCAGAGAGGCGCGAGCCACAGUCAUUGAACCCAGGAAGUGGAGGUUGCAGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications