Homo sapiens (human) small nucleolar RNA, C/D box 84 (SNORD84)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small nucleolar RNA, C/D box 84 (SNORD84) URS00002B7232_9606

78 nucleotides
9 databases (ENA, Ensembl, GeneCards, HGNC, MalaCards, RefSeq, Rfam, snoDB, snOPY)
Found in 4 other species
47 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD84: SNORD84 is a small nucleolar RNA (snoRNA) that has been studied in various contexts [PMC8431405]. In the context of DNA methylation in whole blood, changes in four CpG sites, including SNORD84, were found to be associated with therapeutic response to methotrexate treatment [PMC8431405]. In E1 transfected cells, SNORD84 showed a 7.31-fold change in expression [PMC8717967]. The role of SNORD84 is still unknown, but it has been found to be significantly upregulated in amyotrophic lateral sclerosis (ALS) [PMC5884852]. Additionally, SNORD84 was included in risk models for different training cohorts [PMC9939161].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GCCAUAUGAUGUUUUCUUUUCGAAAGGUGAGCGCUUUGCGCAGUGAUGACCCUCAUCUAUCACCCUUGACUGAUGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.