Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pteropus alecto (black flying fox) pal-miR-20b-5p URS00002B3783_9402

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAAGUGCUCAUAGUGCAGGUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 32 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-17-P4c_5p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-17-P4c_5p (mature (guide))
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-20b
  4. Callorhinchus milii Cmi-Mir-17-P4c_5p (mature (guide))
  5. Capra hircus miR-20b
  6. Chrysemys picta bellii (western painted turtle) Cpi-Mir-17-P4c_5p (mature (guide))
  7. Columba livia (rock pigeon) cli-miR-20b-5p
  8. Cricetulus griseus (Chinese hamster) cgr-miR-20b
  9. Dasypus novemcinctus (nine-banded armadillo) dno-miR-20b-5p
  10. Echinops telfairi Ete-Mir-17-P4c_5p (mature (guide))
  11. Equus caballus (horse) eca-miR-20b
  12. Gallus gallus gga-miR-20b-5p
  13. Gekko japonicus Gja-Mir-17-P4c_5p (mature (guide))
  14. Gorilla gorilla gorilla ggo-miR-20b (MIR20B)
  15. Gorilla gorilla (western gorilla) ggo-miR-20b
  16. Homo sapiens (human) hsa-miR-20b-5p
  17. Macaca mulatta (Rhesus monkey) mml-miR-20b-5p
  18. Monodelphis domestica mdo-miR-20b-5p
  19. Mus musculus (house mouse) mmu-miR-20b-5p
  20. Ornithorhynchus anatinus oan-miR-20b-5p
  21. Oryctolagus cuniculus (rabbit) Ocu-Mir-17-P4c_5p (mature (guide))
  22. Ovis aries miscellaneous RNA
  23. Pan troglodytes ptr-miR-20b
  24. Pongo pygmaeus (Bornean orangutan) ppy-miR-20b
  25. Python bivittatus pbv-miR-20b-5p
  26. Rattus norvegicus (Norway rat) rno-miR-20b-5p
  27. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-17-P4c_5p (mature (guide))
  28. Scyliorhinus torazame Sto-Mir-17-P4c_5p (mature (guide))
  29. Sphenodon punctatus (tuatara) Spt-Mir-17-P4c_5p (mature (guide))
  30. Taeniopygia guttata tgu-miR-20b-5p
  31. Xenopus laevis xla-miR-20
  32. Xenopus tropicalis (tropical clawed frog) xtr-miR-20b